RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0223166690:

Variant ID: vg0223166690 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 23166690
Reference Allele: C	Alternative Allele: T,A
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

ATTATTAACTTTCACGTGATCAAAATATCTTACTGAAGCTTAGATATAACAACAAACCAAACAACCTACTTCACTACTCGCTCTGTCCAAAAAAAAAAGG[C/T,A]
AAACCACGGATTTCCGTGCCAACATTTGATTGTCCGTCTTATATGAAAATTTTTTATAATTAGTATTTTTATTGTTGTTAGATGATAAAACATGATTAAT

Reverse complement sequence

ATTAATCATGTTTTATCATCTAACAACAATAAAAATACTAATTATAAAAAATTTTCATATAAGACGGACAATCAAATGTTGGCACGGAAATCCGTGGTTT[G/A,T]
CCTTTTTTTTTTGGACAGAGCGAGTAGTGAAGTAGGTTGTTTGGTTTGTTGTTATATCTAAGCTTCAGTAAGATATTTTGATCACGTGAAAGTTAATAAT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	69.50%	26.00%	3.98%	0.34%	A: 0.21%
All Indica	2759	53.20%	39.70%	6.23%	0.54%	A: 0.29%
All Japonica	1512	98.80%	0.90%	0.13%	0.00%	A: 0.13%
Aus	269	60.20%	36.40%	3.35%	0.00%	NA
Indica I	595	27.40%	65.20%	7.06%	0.34%	NA
Indica II	465	60.90%	32.70%	6.02%	0.43%	NA
Indica III	913	60.90%	32.40%	5.48%	0.55%	A: 0.66%
Indica Intermediate	786	59.40%	33.00%	6.62%	0.76%	A: 0.25%
Temperate Japonica	767	99.60%	0.30%	0.00%	0.00%	A: 0.13%
Tropical Japonica	504	97.40%	2.40%	0.20%	0.00%	NA
Japonica Intermediate	241	99.20%	0.00%	0.41%	0.00%	A: 0.41%
VI/Aromatic	96	89.60%	6.20%	3.12%	1.04%	NA
Intermediate	90	81.10%	16.70%	2.22%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223166690	C -> A	LOC_Os02g38300.1	upstream_gene_variant ; 3308.0bp to feature; MODIFIER	silent_mutation	Average:65.529; most accessible tissue: Callus, score: 87.992	N	N	N	N
vg0223166690	C -> A	LOC_Os02g38310.1	upstream_gene_variant ; 930.0bp to feature; MODIFIER	silent_mutation	Average:65.529; most accessible tissue: Callus, score: 87.992	N	N	N	N
vg0223166690	C -> A	LOC_Os02g38300.2	upstream_gene_variant ; 3347.0bp to feature; MODIFIER	silent_mutation	Average:65.529; most accessible tissue: Callus, score: 87.992	N	N	N	N
vg0223166690	C -> A	LOC_Os02g38310-LOC_Os02g38320	intergenic_region ; MODIFIER	silent_mutation	Average:65.529; most accessible tissue: Callus, score: 87.992	N	N	N	N
vg0223166690	C -> T	LOC_Os02g38300.1	upstream_gene_variant ; 3308.0bp to feature; MODIFIER	silent_mutation	Average:65.529; most accessible tissue: Callus, score: 87.992	N	N	N	N
vg0223166690	C -> T	LOC_Os02g38310.1	upstream_gene_variant ; 930.0bp to feature; MODIFIER	silent_mutation	Average:65.529; most accessible tissue: Callus, score: 87.992	N	N	N	N
vg0223166690	C -> T	LOC_Os02g38300.2	upstream_gene_variant ; 3347.0bp to feature; MODIFIER	silent_mutation	Average:65.529; most accessible tissue: Callus, score: 87.992	N	N	N	N
vg0223166690	C -> T	LOC_Os02g38310-LOC_Os02g38320	intergenic_region ; MODIFIER	silent_mutation	Average:65.529; most accessible tissue: Callus, score: 87.992	N	N	N	N
vg0223166690	C -> DEL	N	N	silent_mutation	Average:65.529; most accessible tissue: Callus, score: 87.992	N	N	N	N

Showing 1 to 9 of 9 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0223166690	NA	3.49E-16	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223166690	NA	9.96E-09	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223166690	NA	3.62E-08	mr1071	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223166690	4.84E-08	1.60E-29	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223166690	3.34E-06	5.14E-11	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223166690	NA	9.97E-08	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223166690	NA	2.14E-08	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223166690	NA	2.88E-19	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223166690	NA	8.47E-09	mr1077	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223166690	NA	4.41E-08	mr1080	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 73 entries

Previous1 2 3 4 5…8Next

Search for Variation information by Variation ID:

Detailed information for vg0223166690:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact