\
| Variant ID: vg0223147995 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 23147995 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GGCTTCAACTTGCTTTTTCATTTGTTCCATTCTGGCGGCTTGCGCTGTTTGAGATCCAGATGGTTGAGGATACAGTTATGTTGGCCTAAATCAATGGAAC[A/G]
GATCTGGATGATTACCTTTTGATGAACCACTTAGTTCGAAGTTTGCATCCTGGAGCTGAGCGATTCGATCCCTTAACTCCTTCTCCGTCTTCTTGGCGTG
CACGCCAAGAAGACGGAGAAGGAGTTAAGGGATCGAATCGCTCAGCTCCAGGATGCAAACTTCGAACTAAGTGGTTCATCAAAAGGTAATCATCCAGATC[T/C]
GTTCCATTGATTTAGGCCAACATAACTGTATCCTCAACCATCTGGATCTCAAACAGCGCAAGCCGCCAGAATGGAACAAATGAAAAAGCAAGTTGAAGCC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 24.60% | 0.10% | 1.46% | 73.85% | NA |
| All Indica | 2759 | 3.40% | 0.20% | 1.12% | 95.25% | NA |
| All Japonica | 1512 | 66.70% | 0.10% | 1.85% | 31.35% | NA |
| Aus | 269 | 1.10% | 0.00% | 0.37% | 98.51% | NA |
| Indica I | 595 | 4.70% | 0.70% | 2.02% | 92.61% | NA |
| Indica II | 465 | 1.90% | 0.00% | 0.65% | 97.42% | NA |
| Indica III | 913 | 1.80% | 0.10% | 1.20% | 96.93% | NA |
| Indica Intermediate | 786 | 5.30% | 0.00% | 0.64% | 94.02% | NA |
| Temperate Japonica | 767 | 82.40% | 0.00% | 1.96% | 15.65% | NA |
| Tropical Japonica | 504 | 36.50% | 0.20% | 1.98% | 61.31% | NA |
| Japonica Intermediate | 241 | 80.10% | 0.00% | 1.24% | 18.67% | NA |
| VI/Aromatic | 96 | 28.10% | 0.00% | 7.29% | 64.58% | NA |
| Intermediate | 90 | 30.00% | 0.00% | 2.22% | 67.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0223147995 | A -> G | LOC_Os02g38260.1 | downstream_gene_variant ; 3723.0bp to feature; MODIFIER | silent_mutation | Average:11.246; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0223147995 | A -> G | LOC_Os02g38270.1 | downstream_gene_variant ; 998.0bp to feature; MODIFIER | silent_mutation | Average:11.246; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0223147995 | A -> G | LOC_Os02g38290.1 | downstream_gene_variant ; 4697.0bp to feature; MODIFIER | silent_mutation | Average:11.246; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0223147995 | A -> G | LOC_Os02g38290.2 | downstream_gene_variant ; 4694.0bp to feature; MODIFIER | silent_mutation | Average:11.246; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0223147995 | A -> G | LOC_Os02g38280.1 | intron_variant ; MODIFIER | silent_mutation | Average:11.246; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| vg0223147995 | A -> DEL | N | N | silent_mutation | Average:11.246; most accessible tissue: Zhenshan97 panicle, score: 24.575 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0223147995 | NA | 3.32E-06 | mr1083 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223147995 | NA | 6.47E-08 | mr1226 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223147995 | NA | 4.19E-08 | mr1411 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223147995 | 1.36E-06 | NA | mr1298_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223147995 | 3.52E-06 | NA | mr1731_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223147995 | NA | 7.26E-06 | mr1736_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223147995 | 9.42E-06 | NA | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0223147995 | 2.00E-06 | NA | mr1944_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |