\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223115199:

Variant ID: vg0223115199 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23115199
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


ACGGCTAGCATCTCTTGTGTTTCTGTGTATGATGTGAGCTTGCTTTGCAGGGGATCTCATTCCCTTCCTCTTGCAACTCTGAAAGGGCCAACGAAATTCT[A/C]
AACTAAGCCTCTGACCTGCTTGGGCATATTCCAGATAATTAGAATCGAACAGTGTACATTTCTCTCTTGTAAAACTCATATTGTTCGAGAAAAATTGGCT

Reverse complement sequence

AGCCAATTTTTCTCGAACAATATGAGTTTTACAAGAGAGAAATGTACACTGTTCGATTCTAATTATCTGGAATATGCCCAAGCAGGTCAGAGGCTTAGTT[T/G]
AGAATTTCGTTGGCCCTTTCAGAGTTGCAAGAGGAAGGGAATGAGATCCCCTGCAAAGCAAGCTCACATCATACACAGAAACACAAGAGATGCTAGCCGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.00% 31.70% 0.30% 0.00% NA
All Indica  2759 95.50% 4.40% 0.04% 0.00% NA
All Japonica  1512 14.00% 85.30% 0.79% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 97.00% 2.90% 0.17% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 93.40% 6.60% 0.00% 0.00% NA
Indica Intermediate  786 96.10% 3.90% 0.00% 0.00% NA
Temperate Japonica  767 10.20% 88.30% 1.56% 0.00% NA
Tropical Japonica  504 12.90% 87.10% 0.00% 0.00% NA
Japonica Intermediate  241 28.20% 71.80% 0.00% 0.00% NA
VI/Aromatic  96 61.50% 38.50% 0.00% 0.00% NA
Intermediate  90 45.60% 53.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223115199 A -> C LOC_Os02g38200.1 upstream_gene_variant ; 4809.0bp to feature; MODIFIER silent_mutation Average:85.981; most accessible tissue: Minghui63 flag leaf, score: 96.239 N N N N
vg0223115199 A -> C LOC_Os02g38220.1 upstream_gene_variant ; 941.0bp to feature; MODIFIER silent_mutation Average:85.981; most accessible tissue: Minghui63 flag leaf, score: 96.239 N N N N
vg0223115199 A -> C LOC_Os02g38210.1 downstream_gene_variant ; 1270.0bp to feature; MODIFIER silent_mutation Average:85.981; most accessible tissue: Minghui63 flag leaf, score: 96.239 N N N N
vg0223115199 A -> C LOC_Os02g38210-LOC_Os02g38220 intergenic_region ; MODIFIER silent_mutation Average:85.981; most accessible tissue: Minghui63 flag leaf, score: 96.239 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0223115199 A C -0.06 0.01 0.03 -0.02 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223115199 NA 2.88E-15 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223115199 NA 2.49E-17 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223115199 NA 2.79E-24 mr1548 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223115199 NA 1.76E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223115199 NA 1.13E-08 mr1637 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223115199 NA 2.01E-15 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223115199 2.30E-06 NA mr1064_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223115199 NA 5.40E-07 mr1064_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223115199 NA 2.79E-13 mr1191_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223115199 6.25E-06 6.25E-06 mr1197_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223115199 NA 9.85E-49 mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223115199 2.10E-07 NA mr1546_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223115199 2.25E-07 5.55E-08 mr1546_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223115199 NA 6.76E-29 mr1631_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223115199 6.96E-06 3.10E-17 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251