Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0223104293:

Variant ID: vg0223104293 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 23104293
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.77, T: 0.24, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:

AACCTATTTTTCAGTTTGTTTGGTTTGAGGACAAATAAGATGGGATGATCCATGACACAGAATATTCCCCTAAGACCAAGATCAAGTTAGCCTAGTCCCT[T/C]
AGAAATTGGCGGACCAATTCAACCTATTATTTTTCTCACTGACACGTGGAGAAAATTCCAATTCTAAAAATAAATCTAAACATACACCATATTCAAATTA

Reverse complement sequence

TAATTTGAATATGGTGTATGTTTAGATTTATTTTTAGAATTGGAATTTTCTCCACGTGTCAGTGAGAAAAATAATAGGTTGAATTGGTCCGCCAATTTCT[A/G]
AGGGACTAGGCTAACTTGATCTTGGTCTTAGGGGAATATTCTGTGTCATGGATCATCCCATCTTATTTGTCCTCAAACCAAACAAACTGAAAAATAGGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.20%	28.30%	0.47%	0.00%	NA
All Indica	2759	96.90%	2.60%	0.54%	0.00%	NA
All Japonica	1512	19.60%	80.00%	0.33%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	95.80%	2.40%	1.85%	0.00%	NA
Indica II	465	98.90%	0.90%	0.22%	0.00%	NA
Indica III	913	95.80%	3.90%	0.22%	0.00%	NA
Indica Intermediate	786	97.70%	2.20%	0.13%	0.00%	NA
Temperate Japonica	767	13.30%	86.30%	0.39%	0.00%	NA
Tropical Japonica	504	22.80%	77.00%	0.20%	0.00%	NA
Japonica Intermediate	241	33.20%	66.40%	0.41%	0.00%	NA
VI/Aromatic	96	78.10%	21.90%	0.00%	0.00%	NA
Intermediate	90	57.80%	40.00%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223104293	T -> C	LOC_Os02g38180.1	upstream_gene_variant ; 1549.0bp to feature; MODIFIER	silent_mutation	Average:68.359; most accessible tissue: Callus, score: 89.305	N	N	N	N
vg0223104293	T -> C	LOC_Os02g38190.1	downstream_gene_variant ; 1247.0bp to feature; MODIFIER	silent_mutation	Average:68.359; most accessible tissue: Callus, score: 89.305	N	N	N	N
vg0223104293	T -> C	LOC_Os02g38200.1	downstream_gene_variant ; 2638.0bp to feature; MODIFIER	silent_mutation	Average:68.359; most accessible tissue: Callus, score: 89.305	N	N	N	N
vg0223104293	T -> C	LOC_Os02g38180-LOC_Os02g38190	intergenic_region ; MODIFIER	silent_mutation	Average:68.359; most accessible tissue: Callus, score: 89.305	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0223104293	NA	4.18E-06	mr1120	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223104293	9.02E-08	NA	mr1334	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223104293	NA	2.42E-06	mr1113_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223104293	NA	4.96E-18	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223104293	NA	7.84E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223104293	NA	6.52E-18	mr1240_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223104293	NA	2.24E-22	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223104293	NA	8.80E-13	mr1258_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223104293	NA	2.54E-13	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223104293	NA	2.49E-18	mr1817_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251