Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0223096991:

Variant ID: vg0223096991 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 23096991
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, A: 0.01, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

AATTGGATATCGAATAGTGAAATTTCTCAAAACTTTGATTATCTAGCCACTAGCAGCAGACATTAGACGGACCATGGATGCAGGTTCTGCAACAAAAGCT[C/A]
ATCAGAGTCTACACTTGACAGTCACTTGGAGCTTCGGAATATCCCCATAGCATCTTCCATTTCTGTGGCTTGAATCTGGGGTGTTCATGTCAGCAGCAGA

Reverse complement sequence

TCTGCTGCTGACATGAACACCCCAGATTCAAGCCACAGAAATGGAAGATGCTATGGGGATATTCCGAAGCTCCAAGTGACTGTCAAGTGTAGACTCTGAT[G/T]
AGCTTTTGTTGCAGAACCTGCATCCATGGTCCGTCTAATGTCTGCTGCTAGTGGCTAGATAATCAAAGTTTTGAGAAATTTCACTATTCGATATCCAATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.10%	5.60%	0.25%	0.00%	NA
All Indica	2759	99.10%	0.90%	0.07%	0.00%	NA
All Japonica	1512	85.40%	14.00%	0.60%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.30%	0.50%	0.17%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	98.60%	1.40%	0.00%	0.00%	NA
Indica Intermediate	786	98.90%	1.00%	0.13%	0.00%	NA
Temperate Japonica	767	88.50%	10.80%	0.65%	0.00%	NA
Tropical Japonica	504	87.30%	12.70%	0.00%	0.00%	NA
Japonica Intermediate	241	71.80%	26.60%	1.66%	0.00%	NA
VI/Aromatic	96	78.10%	21.90%	0.00%	0.00%	NA
Intermediate	90	87.80%	11.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223096991	C -> A	LOC_Os02g38170.1	upstream_gene_variant ; 1055.0bp to feature; MODIFIER	silent_mutation	Average:86.273; most accessible tissue: Minghui63 flag leaf, score: 98.209	N	N	N	N
vg0223096991	C -> A	LOC_Os02g38180.1	downstream_gene_variant ; 1487.0bp to feature; MODIFIER	silent_mutation	Average:86.273; most accessible tissue: Minghui63 flag leaf, score: 98.209	N	N	N	N
vg0223096991	C -> A	LOC_Os02g38160-LOC_Os02g38170	intergenic_region ; MODIFIER	silent_mutation	Average:86.273; most accessible tissue: Minghui63 flag leaf, score: 98.209	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0223096991	C	A	-0.03	0.0	0.03	-0.06	-0.02	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0223096991	1.30E-12	NA	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223096991	2.65E-06	NA	mr1334	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223096991	4.18E-06	NA	mr1071_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223096991	3.14E-06	NA	mr1080_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223096991	6.09E-07	NA	mr1100_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223096991	NA	6.41E-07	mr1113_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223096991	NA	2.87E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223096991	NA	7.15E-06	mr1119_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223096991	NA	6.81E-06	mr1120_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223096991	8.73E-07	NA	mr1203_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223096991	NA	9.08E-06	mr1240_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223096991	3.10E-09	NA	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223096991	1.79E-06	NA	mr1613_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251