\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223078644:

Variant ID: vg0223078644 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23078644
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.07, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


AAATGATTGTTGTTTTTTTTTTCTTACCAGCCCTAGCGCACTCCGATAGGAATTACTACATCCGTTTCACAATGTAAATCATTCTATTATTTTCCACATT[C/T]
ATATTAATGTTAATAAATCTAGATATATATATCTATCTAGATTTATTAACATCAATATGAATGTGGGAAATGCTAAAATAATTTACAGTGTGAAACGAAG

Reverse complement sequence

CTTCGTTTCACACTGTAAATTATTTTAGCATTTCCCACATTCATATTGATGTTAATAAATCTAGATAGATATATATATCTAGATTTATTAACATTAATAT[G/A]
AATGTGGAAAATAATAGAATGATTTACATTGTGAAACGGATGTAGTAATTCCTATCGGAGTGCGCTAGGGCTGGTAAGAAAAAAAAAACAACAATCATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.90% 39.80% 5.29% 3.94% NA
All Indica  2759 30.40% 56.10% 8.48% 5.00% NA
All Japonica  1512 95.70% 1.90% 0.20% 2.25% NA
Aus  269 1.90% 93.30% 3.72% 1.12% NA
Indica I  595 29.40% 58.50% 10.08% 2.02% NA
Indica II  465 32.70% 48.60% 14.84% 3.87% NA
Indica III  913 24.90% 65.10% 4.49% 5.59% NA
Indica Intermediate  786 36.30% 48.30% 8.14% 7.25% NA
Temperate Japonica  767 95.60% 0.00% 0.26% 4.17% NA
Tropical Japonica  504 95.60% 4.00% 0.20% 0.20% NA
Japonica Intermediate  241 96.30% 3.30% 0.00% 0.41% NA
VI/Aromatic  96 50.00% 39.60% 0.00% 10.42% NA
Intermediate  90 75.60% 20.00% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223078644 C -> T LOC_Os02g38160.1 downstream_gene_variant ; 4462.0bp to feature; MODIFIER silent_mutation Average:54.317; most accessible tissue: Minghui63 root, score: 93.319 N N N N
vg0223078644 C -> T LOC_Os02g38160.2 downstream_gene_variant ; 4462.0bp to feature; MODIFIER silent_mutation Average:54.317; most accessible tissue: Minghui63 root, score: 93.319 N N N N
vg0223078644 C -> T LOC_Os02g38140-LOC_Os02g38160 intergenic_region ; MODIFIER silent_mutation Average:54.317; most accessible tissue: Minghui63 root, score: 93.319 N N N N
vg0223078644 C -> DEL N N silent_mutation Average:54.317; most accessible tissue: Minghui63 root, score: 93.319 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0223078644 C T 0.02 0.02 0.0 0.03 0.03 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223078644 NA 1.32E-12 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223078644 NA 7.55E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223078644 NA 1.95E-06 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223078644 NA 4.18E-18 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223078644 NA 3.24E-07 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223078644 NA 8.62E-24 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223078644 NA 1.30E-06 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223078644 NA 8.05E-11 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223078644 3.79E-07 1.25E-09 mr1224 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223078644 NA 3.16E-06 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223078644 NA 1.07E-12 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223078644 NA 3.66E-06 mr1589 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223078644 NA 2.34E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223078644 NA 7.13E-08 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223078644 NA 2.58E-06 mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223078644 NA 4.66E-17 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223078644 NA 1.20E-32 mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223078644 NA 1.07E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223078644 NA 6.78E-11 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251