\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223072760:

Variant ID: vg0223072760 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 23072760
Reference Allele: TAlternative Allele: A,TA,TAA,TAAA
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTGGATCCGTGTTTTGTCTTCTTCTTTTAAATTTAGAAATTTAATCGGATTACGATTTTGGAAGGAAAAAAAGGGACTACTCGTACAATATATTTTTTT[T/A,TA,TAA,TAAA]
AAAAAATAAAAGAATCTTGTAAAGGTTCATGTGGCGTATTGGTATTGGGTCTATATTTTTCATCTCGGATTGGGATTTGGGAAGCCTTTTCAACAACGGA

Reverse complement sequence

TCCGTTGTTGAAAAGGCTTCCCAAATCCCAATCCGAGATGAAAAATATAGACCCAATACCAATACGCCACATGAACCTTTACAAGATTCTTTTATTTTTT[A/T,TA,TTA,TTTA]
AAAAAAATATATTGTACGAGTAGTCCCTTTTTTTCCTTCCAAAATCGTAATCCGATTAAATTTCTAAATTTAAAAGAAGAAGACAAAACACGGATCCAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.90% 38.70% 6.43% 0.00% TAA: 5.82%; TA: 1.10%; TAAA: 0.04%
All Indica  2759 69.90% 15.50% 6.67% 0.00% TAA: 6.81%; TA: 1.05%; TAAA: 0.04%
All Japonica  1512 6.90% 87.10% 4.96% 0.00% TA: 0.93%; TAA: 0.07%; TAAA: 0.07%
Aus  269 58.40% 1.90% 8.18% 0.00% TAA: 30.86%; TA: 0.74%
Indica I  595 72.40% 16.30% 10.92% 0.00% TA: 0.34%
Indica II  465 52.00% 15.90% 5.38% 0.00% TAA: 25.81%; TA: 0.86%
Indica III  913 79.60% 14.60% 2.85% 0.00% TA: 1.86%; TAA: 0.99%; TAAA: 0.11%
Indica Intermediate  786 67.30% 15.80% 8.65% 0.00% TAA: 7.51%; TA: 0.76%
Temperate Japonica  767 2.20% 92.20% 5.61% 0.00% NA
Tropical Japonica  504 13.70% 80.20% 3.17% 0.00% TA: 2.78%; TAAA: 0.20%
Japonica Intermediate  241 7.50% 85.50% 6.64% 0.00% TAA: 0.41%
VI/Aromatic  96 53.10% 26.00% 13.54% 0.00% TA: 5.21%; TAA: 2.08%
Intermediate  90 27.80% 57.80% 11.11% 0.00% TA: 2.22%; TAA: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223072760 T -> A LOC_Os02g38140.1 upstream_gene_variant ; 767.0bp to feature; MODIFIER silent_mutation Average:95.697; most accessible tissue: Callus, score: 96.908 N N N N
vg0223072760 T -> A LOC_Os02g38140.2 upstream_gene_variant ; 225.0bp to feature; MODIFIER silent_mutation Average:95.697; most accessible tissue: Callus, score: 96.908 N N N N
vg0223072760 T -> A LOC_Os02g38140-LOC_Os02g38160 intergenic_region ; MODIFIER silent_mutation Average:95.697; most accessible tissue: Callus, score: 96.908 N N N N
vg0223072760 T -> TAAA LOC_Os02g38140.1 upstream_gene_variant ; 768.0bp to feature; MODIFIER silent_mutation Average:95.697; most accessible tissue: Callus, score: 96.908 N N N N
vg0223072760 T -> TAAA LOC_Os02g38140.2 upstream_gene_variant ; 226.0bp to feature; MODIFIER silent_mutation Average:95.697; most accessible tissue: Callus, score: 96.908 N N N N
vg0223072760 T -> TAAA LOC_Os02g38140-LOC_Os02g38160 intergenic_region ; MODIFIER silent_mutation Average:95.697; most accessible tissue: Callus, score: 96.908 N N N N
vg0223072760 T -> TA LOC_Os02g38140.1 upstream_gene_variant ; 768.0bp to feature; MODIFIER silent_mutation Average:95.697; most accessible tissue: Callus, score: 96.908 N N N N
vg0223072760 T -> TA LOC_Os02g38140.2 upstream_gene_variant ; 226.0bp to feature; MODIFIER silent_mutation Average:95.697; most accessible tissue: Callus, score: 96.908 N N N N
vg0223072760 T -> TA LOC_Os02g38140-LOC_Os02g38160 intergenic_region ; MODIFIER silent_mutation Average:95.697; most accessible tissue: Callus, score: 96.908 N N N N
vg0223072760 T -> TAA LOC_Os02g38140.1 upstream_gene_variant ; 768.0bp to feature; MODIFIER silent_mutation Average:95.697; most accessible tissue: Callus, score: 96.908 N N N N
vg0223072760 T -> TAA LOC_Os02g38140.2 upstream_gene_variant ; 226.0bp to feature; MODIFIER silent_mutation Average:95.697; most accessible tissue: Callus, score: 96.908 N N N N
vg0223072760 T -> TAA LOC_Os02g38140-LOC_Os02g38160 intergenic_region ; MODIFIER silent_mutation Average:95.697; most accessible tissue: Callus, score: 96.908 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0223072760 T A -0.01 -0.03 -0.04 -0.01 -0.02 -0.02
vg0223072760 T TA 0.04 0.12 0.12 0.04 0.05 0.01
vg0223072760 T TAA -0.06 0.11 0.18 0.05 0.03 0.11
vg0223072760 T TAAA -0.11 0.0 0.02 0.01 -0.03 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223072760 NA 4.35E-09 mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 9.66E-15 mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 1.36E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 1.17E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 1.17E-06 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 5.28E-07 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 3.38E-06 mr1095 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 9.47E-06 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 1.66E-06 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 6.22E-08 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 2.37E-07 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 2.14E-07 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 4.88E-07 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 1.98E-07 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 2.89E-13 mr1149 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 2.53E-06 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 9.24E-09 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 4.31E-06 mr1222 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 4.55E-16 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 5.01E-07 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 5.90E-06 mr1589 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 1.70E-17 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 6.29E-06 mr1592 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 5.30E-08 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 3.22E-07 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 1.11E-07 NA mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 7.08E-08 3.60E-09 mr1918 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 1.12E-06 NA mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 4.95E-09 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 1.14E-06 NA mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 1.33E-06 9.23E-12 mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 1.87E-08 mr1074_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 2.32E-07 mr1095_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 2.09E-06 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 1.14E-08 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 6.78E-06 1.38E-09 mr1100_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 4.78E-07 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 7.54E-10 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 2.39E-17 mr1146_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 2.09E-07 mr1146_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 1.64E-06 mr1148_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 2.79E-06 3.44E-11 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 7.78E-06 7.03E-16 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 9.08E-06 8.54E-10 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 3.51E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 8.16E-06 NA mr1861_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 5.41E-06 3.41E-10 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 7.55E-08 mr1863_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 1.59E-06 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 NA 3.81E-07 mr1936_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223072760 3.77E-06 1.18E-10 mr1962_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251