Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0223069005:

Variant ID: vg0223069005 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23069005
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.04, T: 0.01, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


ACATGCATCTGTGCTGCTTGCTGTGATTTATCTGATCGATCACGTTCCTTTGCTATCTACATGTAAAATTACACTCTATATAATTACATATATAATTTAG[G/A]
AAGTTACAATGTAAATACATGCTGACTATTTTTTGGTGAAAAATATGGCGCCATAAATATAGCCAGAATTTTGGTTCAGAGATTTTTGTGCCGATAATTC

Reverse complement sequence

GAATTATCGGCACAAAAATCTCTGAACCAAAATTCTGGCTATATTTATGGCGCCATATTTTTCACCAAAAAATAGTCAGCATGTATTTACATTGTAACTT[C/T]
CTAAATTATATATGTAATTATATAGAGTGTAATTTTACATGTAGATAGCAAAGGAACGTGATCGATCAGATAAATCACAGCAAGCAGCACAGATGCATGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.10% 7.30% 1.84% 0.78% NA
All Indica  2759 88.90% 9.10% 0.98% 1.01% NA
All Japonica  1512 98.70% 0.50% 0.60% 0.20% NA
Aus  269 61.00% 31.20% 7.81% 0.00% NA
Indica I  595 92.40% 7.40% 0.17% 0.00% NA
Indica II  465 73.50% 25.80% 0.65% 0.00% NA
Indica III  913 94.90% 1.50% 1.75% 1.86% NA
Indica Intermediate  786 88.30% 9.40% 0.89% 1.40% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 97.80% 0.40% 1.19% 0.60% NA
Japonica Intermediate  241 98.30% 0.40% 1.24% 0.00% NA
VI/Aromatic  96 63.50% 2.10% 30.21% 4.17% NA
Intermediate  90 95.60% 1.10% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223069005 G -> A LOC_Os02g38130.1 upstream_gene_variant ; 2456.0bp to feature; MODIFIER silent_mutation Average:94.95; most accessible tissue: Minghui63 flower, score: 98.755 N N N N
vg0223069005 G -> A LOC_Os02g38140.1 downstream_gene_variant ; 618.0bp to feature; MODIFIER silent_mutation Average:94.95; most accessible tissue: Minghui63 flower, score: 98.755 N N N N
vg0223069005 G -> A LOC_Os02g38140.2 downstream_gene_variant ; 618.0bp to feature; MODIFIER silent_mutation Average:94.95; most accessible tissue: Minghui63 flower, score: 98.755 N N N N
vg0223069005 G -> A LOC_Os02g38130-LOC_Os02g38140 intergenic_region ; MODIFIER silent_mutation Average:94.95; most accessible tissue: Minghui63 flower, score: 98.755 N N N N
vg0223069005 G -> DEL N N silent_mutation Average:94.95; most accessible tissue: Minghui63 flower, score: 98.755 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0223069005 G A -0.01 0.0 -0.01 0.0 0.0 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223069005 6.52E-06 NA mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 6.20E-06 NA mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 1.17E-06 NA mr1069 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 3.67E-07 5.34E-10 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 8.31E-07 2.10E-09 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 1.73E-06 6.27E-08 mr1075 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 6.73E-06 1.67E-07 mr1076 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 2.70E-07 3.16E-11 mr1077 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 NA 1.26E-06 mr1082 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 NA 5.71E-06 mr1083 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 NA 1.64E-06 mr1085 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 NA 3.49E-07 mr1086 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 3.75E-06 1.20E-09 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 4.55E-08 NA mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 9.75E-08 8.73E-09 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 NA 5.46E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 4.50E-06 3.70E-07 mr1183 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 NA 1.15E-07 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 3.18E-06 5.58E-09 mr1226 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 NA 8.12E-06 mr1402 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 8.05E-06 NA mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 5.74E-06 7.87E-10 mr1441 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 9.29E-06 7.37E-07 mr1503 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 NA 6.13E-06 mr1564 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 NA 9.40E-06 mr1592 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 NA 2.76E-06 mr1609 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 NA 1.15E-06 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 9.02E-07 NA mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 4.03E-07 1.40E-08 mr1861 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 3.50E-06 3.46E-07 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 7.77E-06 NA mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 1.25E-06 4.80E-09 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 NA 2.11E-06 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 7.65E-06 4.20E-06 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 NA 7.71E-08 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 3.26E-06 3.10E-06 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223069005 NA 6.71E-06 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251