\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223062888:

Variant ID: vg0223062888 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23062888
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.92, G: 0.09, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


GGAAAACAGAGCGGCTCCTCATCACCATGAACCTGGGAATTATAGACTCACGAATGGCTCAACCATGGGCAATAGAAATGCATGGGTTCTCATGATCATC[T/G]
TTTAGGAGGAACCACGAAATATGCAAGTTTGTGACAAAGAGAGTCGAACTAAGACATACCTACACACCTACATGCTCTCCCATAGAGTTAAATAGCTGGA

Reverse complement sequence

TCCAGCTATTTAACTCTATGGGAGAGCATGTAGGTGTGTAGGTATGTCTTAGTTCGACTCTCTTTGTCACAAACTTGCATATTTCGTGGTTCCTCCTAAA[A/C]
GATGATCATGAGAACCCATGCATTTCTATTGCCCATGGTTGAGCCATTCGTGAGTCTATAATTCCCAGGTTCATGGTGATGAGGAGCCGCTCTGTTTTCC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.00% 20.00% 0.02% 0.00% NA
All Indica  2759 73.40% 26.60% 0.00% 0.00% NA
All Japonica  1512 98.40% 1.60% 0.00% 0.00% NA
Aus  269 44.60% 55.00% 0.37% 0.00% NA
Indica I  595 60.50% 39.50% 0.00% 0.00% NA
Indica II  465 53.10% 46.90% 0.00% 0.00% NA
Indica III  913 91.70% 8.30% 0.00% 0.00% NA
Indica Intermediate  786 73.80% 26.20% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 70.80% 29.20% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223062888 T -> G LOC_Os02g38130.1 3_prime_UTR_variant ; 289.0bp to feature; MODIFIER silent_mutation Average:87.039; most accessible tissue: Minghui63 root, score: 91.763 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0223062888 T G -0.01 -0.01 -0.01 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223062888 NA 5.14E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223062888 6.95E-06 NA mr1224 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223062888 1.42E-06 5.18E-09 mr1224 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223062888 7.77E-06 2.89E-07 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223062888 NA 4.73E-07 mr1224_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251