Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223043180:

Variant ID: vg0223043180 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23043180
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.65, A: 0.35, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:


TAGGGGCTGCGGTGGCTCTCATCGGCACCGGCAGCCCTAGGGACTGCGACGGAAGACGATGGCGGTTTCCGTCGGCGCCGGCGGCACTAGGGGTTGCGGC[A/G]
GCCCAGGACGGCGGTGGCTCCCGTCGGTGCCGGTGGCCCTAGAGGCTGCGGCGGAGGACGGCGGCAGCTTCCGTTGGCGTTGGTGGCCCTAGGGGCGGTG

Reverse complement sequence

CACCGCCCCTAGGGCCACCAACGCCAACGGAAGCTGCCGCCGTCCTCCGCCGCAGCCTCTAGGGCCACCGGCACCGACGGGAGCCACCGCCGTCCTGGGC[T/C]
GCCGCAACCCCTAGTGCCGCCGGCGCCGACGGAAACCGCCATCGTCTTCCGTCGCAGTCCCTAGGGCTGCCGGTGCCGATGAGAGCCACCGCAGCCCCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.60% 40.20% 0.57% 0.61% NA
All Indica  2759 87.90% 10.40% 0.72% 1.01% NA
All Japonica  1512 2.20% 97.40% 0.40% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 82.50% 16.50% 0.50% 0.50% NA
Indica II  465 96.60% 1.10% 1.51% 0.86% NA
Indica III  913 86.10% 12.70% 0.22% 0.99% NA
Indica Intermediate  786 88.80% 8.70% 1.02% 1.53% NA
Temperate Japonica  767 1.00% 98.40% 0.52% 0.00% NA
Tropical Japonica  504 4.20% 95.40% 0.40% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 10.40% 88.50% 1.04% 0.00% NA
Intermediate  90 40.00% 58.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223043180 A -> G LOC_Os02g38110.1 upstream_gene_variant ; 4879.0bp to feature; MODIFIER silent_mutation Average:81.058; most accessible tissue: Zhenshan97 panicle, score: 91.992 N N N N
vg0223043180 A -> G LOC_Os02g38120.1 upstream_gene_variant ; 1370.0bp to feature; MODIFIER silent_mutation Average:81.058; most accessible tissue: Zhenshan97 panicle, score: 91.992 N N N N
vg0223043180 A -> G LOC_Os02g38110-LOC_Os02g38120 intergenic_region ; MODIFIER silent_mutation Average:81.058; most accessible tissue: Zhenshan97 panicle, score: 91.992 N N N N
vg0223043180 A -> DEL N N silent_mutation Average:81.058; most accessible tissue: Zhenshan97 panicle, score: 91.992 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0223043180 A G -0.03 -0.02 -0.01 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223043180 3.80E-06 NA mr1067 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 NA 1.04E-28 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 NA 1.33E-30 mr1074 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 NA 1.19E-28 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 NA 3.40E-41 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 NA 4.52E-16 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 NA 7.93E-27 mr1148 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 NA 1.18E-30 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 NA 1.24E-07 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 NA 9.26E-55 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 NA 1.10E-60 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 1.33E-08 NA mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 6.19E-09 NA mr1067_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 1.76E-06 9.66E-41 mr1072_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 6.01E-06 NA mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 1.28E-07 2.02E-41 mr1075_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 2.87E-06 NA mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 4.46E-07 NA mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 5.64E-06 NA mr1100_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 NA 1.67E-56 mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 NA 5.81E-27 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 3.19E-06 3.34E-19 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 NA 3.68E-11 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 NA 1.04E-10 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 6.17E-06 NA mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 NA 7.19E-08 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 NA 4.54E-06 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 2.04E-06 NA mr1795_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 7.09E-06 NA mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 NA 4.24E-35 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 NA 2.05E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 NA 8.72E-10 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 1.32E-06 NA mr1962_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223043180 3.44E-06 NA mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251