\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223039697:

Variant ID: vg0223039697 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23039697
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCGAGTTCATCGTCTTGGCTACGGCTGGCGTGGCCGAGGAAGAGGAGGAGACGACGAAGCCGGCAGTGGCCTCACTGAGACTCGGCGACGTCTAGGGC[A/G]
GCGCCTAACGGTGGCTGGAGTGCGTGACGGCGATGGAGCGAGCGTGGCGCTCGAGCGGCACGGGGATGGGAAAGAGCAGGTCTTGGGGATTCTCTTTATA

Reverse complement sequence

TATAAAGAGAATCCCCAAGACCTGCTCTTTCCCATCCCCGTGCCGCTCGAGCGCCACGCTCGCTCCATCGCCGTCACGCACTCCAGCCACCGTTAGGCGC[T/C]
GCCCTAGACGTCGCCGAGTCTCAGTGAGGCCACTGCCGGCTTCGTCGTCTCCTCCTCTTCCTCGGCCACGCCAGCCGTAGCCAAGACGATGAACTCGAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 38.00% 0.44% 1.95% NA
All Indica  2759 89.30% 9.40% 0.22% 1.05% NA
All Japonica  1512 2.50% 92.70% 0.79% 4.03% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 83.00% 16.30% 0.34% 0.34% NA
Indica II  465 98.90% 0.60% 0.22% 0.22% NA
Indica III  913 87.40% 11.20% 0.00% 1.42% NA
Indica Intermediate  786 90.60% 7.40% 0.38% 1.65% NA
Temperate Japonica  767 1.20% 98.00% 0.78% 0.00% NA
Tropical Japonica  504 4.40% 82.70% 1.19% 11.71% NA
Japonica Intermediate  241 2.90% 96.30% 0.00% 0.83% NA
VI/Aromatic  96 10.40% 87.50% 1.04% 1.04% NA
Intermediate  90 43.30% 53.30% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223039697 A -> G LOC_Os02g38110.1 upstream_gene_variant ; 1396.0bp to feature; MODIFIER silent_mutation Average:84.0; most accessible tissue: Zhenshan97 panicle, score: 93.455 N N N N
vg0223039697 A -> G LOC_Os02g38120.1 upstream_gene_variant ; 4853.0bp to feature; MODIFIER silent_mutation Average:84.0; most accessible tissue: Zhenshan97 panicle, score: 93.455 N N N N
vg0223039697 A -> G LOC_Os02g38100.1 downstream_gene_variant ; 4108.0bp to feature; MODIFIER silent_mutation Average:84.0; most accessible tissue: Zhenshan97 panicle, score: 93.455 N N N N
vg0223039697 A -> G LOC_Os02g38110-LOC_Os02g38120 intergenic_region ; MODIFIER silent_mutation Average:84.0; most accessible tissue: Zhenshan97 panicle, score: 93.455 N N N N
vg0223039697 A -> DEL N N silent_mutation Average:84.0; most accessible tissue: Zhenshan97 panicle, score: 93.455 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0223039697 A G 0.01 0.01 0.0 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223039697 NA 2.72E-27 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 NA 3.95E-32 mr1074 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 NA 2.17E-28 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 5.85E-06 NA mr1099 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 4.67E-06 NA mr1099 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 1.92E-06 NA mr1101 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 NA 2.68E-40 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 NA 3.49E-17 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 8.98E-07 2.88E-06 mr1146 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 NA 2.80E-28 mr1148 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 NA 1.48E-29 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 NA 3.46E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 8.72E-06 NA mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 NA 8.17E-54 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 9.30E-07 NA mr1868 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 3.43E-07 6.97E-06 mr1868 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 9.41E-07 NA mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 2.20E-07 NA mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 9.16E-08 NA mr1929 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 NA 6.36E-59 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 3.19E-07 NA mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 NA 2.39E-39 mr1072_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 9.59E-06 2.25E-39 mr1075_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 4.53E-06 NA mr1099_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 NA 1.31E-55 mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 NA 5.31E-26 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 NA 1.41E-17 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 NA 3.48E-11 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 NA 1.29E-10 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 5.19E-07 NA mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223039697 1.59E-07 3.66E-06 mr1929_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251