\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223038405:

Variant ID: vg0223038405 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23038405
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.15, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


TGCCCTCGGCAAGCTCTCCGCGCTACTCGCCGACGGGAAGAGAAAGAGAGAAATAAGGGAGAGGGAGGGAGGCAGAAAGGTTGGAAAGAGAATGACATGT[G/A]
GACCCCACAAGTCAGTGGATCCTATTATAATTTTTGTGTGTGAGTGACAAATTGGTCCCACATATATATTTTTAAATCTAATCTTACATCAGTGCCACGT

Reverse complement sequence

ACGTGGCACTGATGTAAGATTAGATTTAAAAATATATATGTGGGACCAATTTGTCACTCACACACAAAAATTATAATAGGATCCACTGACTTGTGGGGTC[C/T]
ACATGTCATTCTCTTTCCAACCTTTCTGCCTCCCTCCCTCTCCCTTATTTCTCTCTTTCTCTTCCCGTCGGCGAGTAGCGCGGAGAGCTTGCCGAGGGCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.20% 40.40% 0.42% 0.00% NA
All Indica  2759 88.90% 10.70% 0.36% 0.00% NA
All Japonica  1512 2.20% 97.40% 0.46% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 82.40% 17.00% 0.67% 0.00% NA
Indica II  465 98.70% 0.90% 0.43% 0.00% NA
Indica III  913 87.00% 12.90% 0.11% 0.00% NA
Indica Intermediate  786 90.30% 9.30% 0.38% 0.00% NA
Temperate Japonica  767 0.80% 98.80% 0.39% 0.00% NA
Tropical Japonica  504 4.20% 95.40% 0.40% 0.00% NA
Japonica Intermediate  241 2.50% 96.70% 0.83% 0.00% NA
VI/Aromatic  96 10.40% 87.50% 2.08% 0.00% NA
Intermediate  90 38.90% 60.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223038405 G -> A LOC_Os02g38110.1 upstream_gene_variant ; 104.0bp to feature; MODIFIER silent_mutation Average:68.561; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0223038405 G -> A LOC_Os02g38100.1 downstream_gene_variant ; 2816.0bp to feature; MODIFIER silent_mutation Average:68.561; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg0223038405 G -> A LOC_Os02g38110-LOC_Os02g38120 intergenic_region ; MODIFIER silent_mutation Average:68.561; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223038405 NA 1.28E-27 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038405 NA 2.60E-39 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038405 2.19E-06 7.82E-18 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038405 3.61E-06 4.47E-06 mr1146 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038405 NA 4.27E-29 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038405 NA 1.33E-07 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038405 2.95E-07 3.08E-06 mr1224 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038405 6.01E-06 NA mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038405 NA 6.03E-09 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038405 NA 1.02E-09 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038405 NA 2.66E-08 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038405 NA 8.61E-06 mr1858 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038405 NA 8.87E-06 mr1859 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038405 NA 2.03E-53 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038405 5.42E-06 NA mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038405 3.55E-06 1.30E-06 mr1913 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038405 NA 1.17E-60 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038405 NA 3.66E-37 mr1075_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038405 NA 4.41E-54 mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038405 NA 1.14E-31 mr1150_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038405 NA 6.26E-11 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038405 NA 5.70E-10 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251