\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223038233:

Variant ID: vg0223038233 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23038233
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


TGTAGGATACGCGACAGGAGCGACCGCGGCGACTGGCAGCTCTCGATGCCGCCGCTTCGCCCGGCCTTCGCGCCGGCCTTCTCCACCCACCGCCGCCCAC[G/A]
GCTTCACGGCTTCGTGCACTCCCTTGGCGCCTTCCACTCCGCTCCCTCGCCGCCCTCTGCTCCGCCATCCGTGCCCTCGGCAAGCTCTCCGCGCTACTCG

Reverse complement sequence

CGAGTAGCGCGGAGAGCTTGCCGAGGGCACGGATGGCGGAGCAGAGGGCGGCGAGGGAGCGGAGTGGAAGGCGCCAAGGGAGTGCACGAAGCCGTGAAGC[C/T]
GTGGGCGGCGGTGGGTGGAGAAGGCCGGCGCGAAGGCCGGGCGAAGCGGCGGCATCGAGAGCTGCCAGTCGCCGCGGTCGCTCCTGTCGCGTATCCTACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.20% 43.30% 0.57% 0.00% NA
All Indica  2759 87.70% 11.70% 0.58% 0.00% NA
All Japonica  1512 2.20% 97.40% 0.40% 0.00% NA
Aus  269 58.40% 41.60% 0.00% 0.00% NA
Indica I  595 83.20% 16.50% 0.34% 0.00% NA
Indica II  465 97.20% 1.90% 0.86% 0.00% NA
Indica III  913 85.40% 14.00% 0.55% 0.00% NA
Indica Intermediate  786 88.30% 11.10% 0.64% 0.00% NA
Temperate Japonica  767 1.00% 98.80% 0.13% 0.00% NA
Tropical Japonica  504 4.40% 95.20% 0.40% 0.00% NA
Japonica Intermediate  241 1.70% 97.10% 1.24% 0.00% NA
VI/Aromatic  96 9.40% 87.50% 3.12% 0.00% NA
Intermediate  90 36.70% 61.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223038233 G -> A LOC_Os02g38110.1 synonymous_variant ; p.Ala23Ala; LOW synonymous_codon Average:79.678; most accessible tissue: Minghui63 panicle, score: 89.444 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0223038233 G A 0.02 0.01 0.02 0.01 0.03 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223038233 7.68E-06 NA mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038233 4.29E-06 NA mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038233 3.26E-06 NA mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038233 6.96E-06 NA mr1108_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038233 2.01E-06 4.67E-39 mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038233 3.53E-06 NA mr1110_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038233 3.20E-06 NA mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038233 3.15E-06 NA mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038233 6.91E-06 NA mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038233 1.52E-06 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038233 1.25E-06 NA mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038233 7.46E-06 NA mr1119_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038233 2.72E-07 NA mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038233 8.67E-06 NA mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038233 7.59E-08 NA mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038233 NA 9.15E-17 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223038233 NA 3.36E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251