Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223033951:

Variant ID: vg0223033951 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 23033951
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

TATACATATCATCACATTATTTCTACAATATTTTAACAAATATACATATCATTTTTATAATATTTAACATATACTTATCAATATGCTCCACATTAAAAAC[G/A]
GGTATCATTTGTTTATTTTATGATAAGTACCGATAAAACTTCACGTTTCATTATTTTCTATTCTTTTTACTCTTAGTTTACTTGTTGAACAAAATATATT

Reverse complement sequence

AATATATTTTGTTCAACAAGTAAACTAAGAGTAAAAAGAATAGAAAATAATGAAACGTGAAGTTTTATCGGTACTTATCATAAAATAAACAAATGATACC[C/T]
GTTTTTAATGTGGAGCATATTGATAAGTATATGTTAAATATTATAAAAATGATATGTATATTTGTTAAAATATTGTAGAAATAATGTGATGATATGTATA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	41.10%	36.80%	10.37%	11.72%	NA
All Indica	2759	11.50%	52.90%	16.82%	18.85%	NA
All Japonica	1512	97.90%	1.60%	0.26%	0.20%	NA
Aus	269	0.40%	86.60%	5.20%	7.81%	NA
Indica I	595	18.20%	54.30%	13.45%	14.12%	NA
Indica II	465	1.70%	55.90%	21.08%	21.29%	NA
Indica III	913	13.10%	51.60%	15.33%	19.93%	NA
Indica Intermediate	786	10.20%	51.50%	18.58%	19.72%	NA
Temperate Japonica	767	99.30%	0.40%	0.26%	0.00%	NA
Tropical Japonica	504	95.80%	3.80%	0.00%	0.40%	NA
Japonica Intermediate	241	97.90%	0.80%	0.83%	0.41%	NA
VI/Aromatic	96	89.60%	6.20%	2.08%	2.08%	NA
Intermediate	90	64.40%	20.00%	6.67%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0223033951	G -> A	LOC_Os02g38100.1	upstream_gene_variant ; 277.0bp to feature; MODIFIER	silent_mutation	Average:22.591; most accessible tissue: Callus, score: 55.629	N	N	N	N
vg0223033951	G -> A	LOC_Os02g38110.1	downstream_gene_variant ; 3238.0bp to feature; MODIFIER	silent_mutation	Average:22.591; most accessible tissue: Callus, score: 55.629	N	N	N	N
vg0223033951	G -> A	LOC_Os02g38090-LOC_Os02g38100	intergenic_region ; MODIFIER	silent_mutation	Average:22.591; most accessible tissue: Callus, score: 55.629	N	N	N	N
vg0223033951	G -> DEL	N	N	silent_mutation	Average:22.591; most accessible tissue: Callus, score: 55.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0223033951	NA	1.05E-25	mr1024	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951	1.48E-06	NA	mr1067	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951	2.85E-07	NA	mr1067	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951	NA	1.41E-27	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951	NA	4.28E-40	mr1124	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951	NA	5.14E-18	mr1146	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951	NA	1.18E-21	mr1150	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951	NA	4.94E-30	mr1202	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951	NA	2.88E-08	mr1222	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951	NA	9.80E-14	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951	NA	1.59E-58	mr1962	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951	3.01E-08	NA	mr1067_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951	7.53E-07	NA	mr1067_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951	2.16E-06	8.59E-39	mr1072_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951	6.29E-07	7.04E-39	mr1075_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951	4.47E-06	NA	mr1110_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951	NA	1.74E-16	mr1342_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951	7.30E-06	1.90E-18	mr1592_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951	NA	1.77E-11	mr1595_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951	NA	1.63E-11	mr1600_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951	NA	2.18E-19	mr1637_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951	NA	1.46E-07	mr1783_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951	NA	6.16E-36	mr1888_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951	NA	2.46E-09	mr1947_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251