\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0223033951:

Variant ID: vg0223033951 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 23033951
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


TATACATATCATCACATTATTTCTACAATATTTTAACAAATATACATATCATTTTTATAATATTTAACATATACTTATCAATATGCTCCACATTAAAAAC[G/A]
GGTATCATTTGTTTATTTTATGATAAGTACCGATAAAACTTCACGTTTCATTATTTTCTATTCTTTTTACTCTTAGTTTACTTGTTGAACAAAATATATT

Reverse complement sequence

AATATATTTTGTTCAACAAGTAAACTAAGAGTAAAAAGAATAGAAAATAATGAAACGTGAAGTTTTATCGGTACTTATCATAAAATAAACAAATGATACC[C/T]
GTTTTTAATGTGGAGCATATTGATAAGTATATGTTAAATATTATAAAAATGATATGTATATTTGTTAAAATATTGTAGAAATAATGTGATGATATGTATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.10% 36.80% 10.37% 11.72% NA
All Indica  2759 11.50% 52.90% 16.82% 18.85% NA
All Japonica  1512 97.90% 1.60% 0.26% 0.20% NA
Aus  269 0.40% 86.60% 5.20% 7.81% NA
Indica I  595 18.20% 54.30% 13.45% 14.12% NA
Indica II  465 1.70% 55.90% 21.08% 21.29% NA
Indica III  913 13.10% 51.60% 15.33% 19.93% NA
Indica Intermediate  786 10.20% 51.50% 18.58% 19.72% NA
Temperate Japonica  767 99.30% 0.40% 0.26% 0.00% NA
Tropical Japonica  504 95.80% 3.80% 0.00% 0.40% NA
Japonica Intermediate  241 97.90% 0.80% 0.83% 0.41% NA
VI/Aromatic  96 89.60% 6.20% 2.08% 2.08% NA
Intermediate  90 64.40% 20.00% 6.67% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0223033951 G -> A LOC_Os02g38100.1 upstream_gene_variant ; 277.0bp to feature; MODIFIER silent_mutation Average:22.591; most accessible tissue: Callus, score: 55.629 N N N N
vg0223033951 G -> A LOC_Os02g38110.1 downstream_gene_variant ; 3238.0bp to feature; MODIFIER silent_mutation Average:22.591; most accessible tissue: Callus, score: 55.629 N N N N
vg0223033951 G -> A LOC_Os02g38090-LOC_Os02g38100 intergenic_region ; MODIFIER silent_mutation Average:22.591; most accessible tissue: Callus, score: 55.629 N N N N
vg0223033951 G -> DEL N N silent_mutation Average:22.591; most accessible tissue: Callus, score: 55.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0223033951 NA 1.05E-25 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951 1.48E-06 NA mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951 2.85E-07 NA mr1067 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951 NA 1.41E-27 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951 NA 4.28E-40 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951 NA 5.14E-18 mr1146 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951 NA 1.18E-21 mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951 NA 4.94E-30 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951 NA 2.88E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951 NA 9.80E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951 NA 1.59E-58 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951 3.01E-08 NA mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951 7.53E-07 NA mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951 2.16E-06 8.59E-39 mr1072_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951 6.29E-07 7.04E-39 mr1075_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951 4.47E-06 NA mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951 NA 1.74E-16 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951 7.30E-06 1.90E-18 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951 NA 1.77E-11 mr1595_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951 NA 1.63E-11 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951 NA 2.18E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951 NA 1.46E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951 NA 6.16E-36 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0223033951 NA 2.46E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251