\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222982406:

Variant ID: vg0222982406 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22982406
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, T: 0.04, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


AACAGCTAACTTCAGAACCTTGCCAATACATTCGTGCCTGTGAGGCTGTGAGCACTGTCCAGAATAGGGCACATGTGATCTTACCATTTCCTGCAACTCC[T/G]
CCAGGAGAGGGTCCCATTCGCTGACGCCACAGAGATCATCGACAGACTGCTCCAGGTTGTACTTGTTCTGCCTGAGTATCTCCTTGTTCAGATCGACCTG

Reverse complement sequence

CAGGTCGATCTGAACAAGGAGATACTCAGGCAGAACAAGTACAACCTGGAGCAGTCTGTCGATGATCTCTGTGGCGTCAGCGAATGGGACCCTCTCCTGG[A/C]
GGAGTTGCAGGAAATGGTAAGATCACATGTGCCCTATTCTGGACAGTGCTCACAGCCTCACAGGCACGAATGTATTGGCAAGGTTCTGAAGTTAGCTGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.50% 17.90% 0.66% 0.00% NA
All Indica  2759 95.50% 4.40% 0.11% 0.00% NA
All Japonica  1512 61.30% 37.00% 1.72% 0.00% NA
Aus  269 46.80% 53.20% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 97.80% 1.90% 0.22% 0.00% NA
Indica III  913 92.20% 7.80% 0.00% 0.00% NA
Indica Intermediate  786 94.90% 4.80% 0.25% 0.00% NA
Temperate Japonica  767 86.80% 11.30% 1.83% 0.00% NA
Tropical Japonica  504 32.50% 66.10% 1.39% 0.00% NA
Japonica Intermediate  241 40.20% 57.70% 2.07% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 74.40% 23.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222982406 T -> G LOC_Os02g38050.1 missense_variant ; p.Glu806Ala; MODERATE nonsynonymous_codon ; E806A Average:89.267; most accessible tissue: Minghui63 root, score: 96.429 benign -0.446 TOLERATED 1.00
vg0222982406 T -> G LOC_Os02g38050.4 missense_variant ; p.Glu793Ala; MODERATE nonsynonymous_codon ; E793A Average:89.267; most accessible tissue: Minghui63 root, score: 96.429 benign -0.446 TOLERATED 1.00
vg0222982406 T -> G LOC_Os02g38050.3 missense_variant ; p.Glu806Ala; MODERATE nonsynonymous_codon ; E806A Average:89.267; most accessible tissue: Minghui63 root, score: 96.429 benign -0.446 TOLERATED 1.00
vg0222982406 T -> G LOC_Os02g38050.2 missense_variant ; p.Glu806Ala; MODERATE nonsynonymous_codon ; E806A Average:89.267; most accessible tissue: Minghui63 root, score: 96.429 benign -0.446 TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0222982406 T G -0.01 0.0 -0.01 0.0 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222982406 6.60E-08 NA mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222982406 3.06E-08 NA mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222982406 1.52E-06 NA mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222982406 1.51E-07 NA mr1119 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222982406 1.90E-06 NA mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222982406 3.81E-07 NA mr1240 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222982406 4.33E-06 NA mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222982406 NA 1.42E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222982406 2.86E-07 NA mr1496 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222982406 NA 6.15E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222982406 NA 6.18E-09 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222982406 4.83E-07 NA mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222982406 6.36E-06 NA mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222982406 6.05E-07 NA mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222982406 7.35E-06 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222982406 2.31E-06 NA mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222982406 9.49E-06 NA mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222982406 5.27E-06 NA mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222982406 4.51E-08 NA mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251