\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222961957:

Variant ID: vg0222961957 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22961957
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGACTGCCTACGCCAAGCGCATCGTCGAGTTGGGCGGGCTCACCGGCTGCAACCCAGCCTACACTCCCATGGAGGAAAGGTTGAAGCTGAGCCGCGACA[A/G]
CACGGCTGAGGAGGTCGATGCCACGCAGTACCGGCGTATTGTGGGCAGCCTTCGCTACCTCGTCCACACGCGGCCAGACTTGGCATTTGCTGTTGGCTAT

Reverse complement sequence

ATAGCCAACAGCAAATGCCAAGTCTGGCCGCGTGTGGACGAGGTAGCGAAGGCTGCCCACAATACGCCGGTACTGCGTGGCATCGACCTCCTCAGCCGTG[T/C]
TGTCGCGGCTCAGCTTCAACCTTTCCTCCATGGGAGTGTAGGCTGGGTTGCAGCCGGTGAGCCCGCCCAACTCGACGATGCGCTTGGCGTAGGCAGTCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.90% 12.40% 6.75% 0.00% NA
All Indica  2759 86.60% 6.80% 6.56% 0.00% NA
All Japonica  1512 66.70% 24.90% 8.47% 0.00% NA
Aus  269 95.90% 2.20% 1.86% 0.00% NA
Indica I  595 67.60% 17.10% 15.29% 0.00% NA
Indica II  465 86.50% 6.00% 7.53% 0.00% NA
Indica III  913 99.30% 0.20% 0.44% 0.00% NA
Indica Intermediate  786 86.40% 7.10% 6.49% 0.00% NA
Temperate Japonica  767 41.90% 44.60% 13.56% 0.00% NA
Tropical Japonica  504 95.80% 2.00% 2.18% 0.00% NA
Japonica Intermediate  241 84.60% 10.00% 5.39% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 81.10% 14.40% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222961957 A -> G LOC_Os02g38000.1 missense_variant ; p.Asn1245Ser; MODERATE nonsynonymous_codon Average:75.638; most accessible tissue: Zhenshan97 flag leaf, score: 91.557 benign -0.47 TOLERATED 1.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0222961957 A G 0.01 0.01 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222961957 4.50E-07 NA mr1166 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222961957 8.79E-06 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222961957 2.75E-06 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222961957 NA 2.37E-08 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222961957 2.82E-06 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222961957 6.66E-06 NA mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222961957 NA 7.96E-07 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222961957 NA 5.10E-08 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222961957 NA 8.40E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222961957 NA 6.26E-06 mr1977_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251