\
| Variant ID: vg0222948971 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22948971 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.03, others allele: 0.00, population size: 204. )
ATTGCTTATTATAGAAATAGTAAAGGGTTATACACAAAACCTTCAAGTTCACCTTCCACACATAGATGAATCCAATCTTGTATTGTTCAACCGTATAGCT[T/C]
GTGAAAATAGACAAGGGTAAAAAGAGGTGGTCTAGCAACATATTTCAGTATGGCTACCTTCGGAGATGACACTATGTGCTTAATCGACTAACAATGCTAT
ATAGCATTGTTAGTCGATTAAGCACATAGTGTCATCTCCGAAGGTAGCCATACTGAAATATGTTGCTAGACCACCTCTTTTTACCCTTGTCTATTTTCAC[A/G]
AGCTATACGGTTGAACAATACAAGATTGGATTCATCTATGTGTGGAAGGTGAACTTGAAGGTTTTGTGTATAACCCTTTACTATTTCTATAATAAGCAAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.40% | 15.80% | 0.80% | 0.00% | NA |
| All Indica | 2759 | 95.50% | 4.40% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 67.50% | 30.30% | 2.18% | 0.00% | NA |
| Aus | 269 | 46.50% | 53.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.00% | 0.34% | 0.00% | NA |
| Indica II | 465 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 92.00% | 8.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.90% | 4.80% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 92.70% | 5.20% | 2.09% | 0.00% | NA |
| Tropical Japonica | 504 | 38.50% | 59.10% | 2.38% | 0.00% | NA |
| Japonica Intermediate | 241 | 48.10% | 49.80% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 23.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222948971 | T -> C | LOC_Os02g37970-LOC_Os02g37990 | intergenic_region ; MODIFIER | silent_mutation | Average:39.04; most accessible tissue: Callus, score: 65.17 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222948971 | NA | 8.19E-07 | mr1030 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 3.59E-07 | NA | mr1113 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 2.93E-12 | NA | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 3.30E-07 | NA | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 8.65E-09 | NA | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 8.20E-07 | NA | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 1.58E-09 | NA | mr1119 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 9.38E-06 | NA | mr1120 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 8.24E-08 | NA | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 3.34E-11 | NA | mr1240 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 1.02E-09 | NA | mr1242 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 1.98E-07 | NA | mr1247 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | NA | 6.32E-09 | mr1317 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | NA | 5.08E-06 | mr1331 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 2.17E-09 | 8.89E-14 | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | NA | 2.61E-10 | mr1756 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 9.36E-08 | NA | mr1917 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 9.41E-08 | NA | mr1936 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 1.33E-11 | NA | mr1113_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 8.41E-09 | NA | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 1.23E-09 | NA | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 1.95E-07 | NA | mr1118_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 6.44E-09 | NA | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 1.86E-06 | NA | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 3.52E-07 | NA | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 6.39E-08 | NA | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 4.84E-08 | NA | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 9.87E-07 | NA | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | 2.14E-10 | 7.00E-13 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222948971 | NA | 1.53E-09 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |