\
| Variant ID: vg0222926098 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22926098 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.02, others allele: 0.00, population size: 236. )
ATATTAATTCATTTTTCAAGTTTGTAATAATTAAAACTCAATTAGTCGCACATTATTACCACATCGTTTTGCGTGAAACACTTAATCTTTATCTTCAGGA[G/T]
ATTAAAACACCACCTTAGTAATGACAAAACCCAAGAAAATTATACCTTCGCCTTTCTTGTTCATTCTTCTAATATTCCTCTTGCGAAGGGGTACCAGTCG
CGACTGGTACCCCTTCGCAAGAGGAATATTAGAAGAATGAACAAGAAAGGCGAAGGTATAATTTTCTTGGGTTTTGTCATTACTAAGGTGGTGTTTTAAT[C/A]
TCCTGAAGATAAAGATTAAGTGTTTCACGCAAAACGATGTGGTAATAATGTGCGACTAATTGAGTTTTAATTATTACAAACTTGAAAAATGAATTAATAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.20% | 41.80% | 1.02% | 0.00% | NA |
| All Indica | 2759 | 90.60% | 8.00% | 1.41% | 0.00% | NA |
| All Japonica | 1512 | 2.60% | 97.00% | 0.33% | 0.00% | NA |
| Aus | 269 | 45.00% | 54.60% | 0.37% | 0.00% | NA |
| Indica I | 595 | 91.60% | 5.00% | 3.36% | 0.00% | NA |
| Indica II | 465 | 95.70% | 3.00% | 1.29% | 0.00% | NA |
| Indica III | 913 | 87.70% | 12.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.10% | 8.30% | 1.65% | 0.00% | NA |
| Temperate Japonica | 767 | 0.70% | 98.80% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 97.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 10.40% | 89.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 34.40% | 62.20% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222926098 | G -> T | LOC_Os02g37920.1 | upstream_gene_variant ; 1609.0bp to feature; MODIFIER | silent_mutation | Average:64.002; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg0222926098 | G -> T | LOC_Os02g37930.1 | upstream_gene_variant ; 1498.0bp to feature; MODIFIER | silent_mutation | Average:64.002; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg0222926098 | G -> T | LOC_Os02g37940.1 | downstream_gene_variant ; 4875.0bp to feature; MODIFIER | silent_mutation | Average:64.002; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg0222926098 | G -> T | LOC_Os02g37940.2 | downstream_gene_variant ; 4875.0bp to feature; MODIFIER | silent_mutation | Average:64.002; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| vg0222926098 | G -> T | LOC_Os02g37920-LOC_Os02g37930 | intergenic_region ; MODIFIER | silent_mutation | Average:64.002; most accessible tissue: Minghui63 panicle, score: 79.811 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222926098 | NA | 1.94E-35 | mr1110 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222926098 | 7.87E-07 | NA | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222926098 | 1.40E-09 | NA | mr1114 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222926098 | 2.21E-08 | NA | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222926098 | 2.27E-07 | NA | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222926098 | 1.08E-06 | NA | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222926098 | 2.21E-06 | NA | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222926098 | 1.67E-07 | NA | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222926098 | 1.29E-09 | NA | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222926098 | 8.59E-09 | NA | mr1496 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222926098 | NA | 1.16E-14 | mr1592 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222926098 | 7.52E-06 | NA | mr1917 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222926098 | NA | 2.17E-38 | mr1110_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222926098 | 7.77E-07 | NA | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222926098 | 4.98E-08 | NA | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222926098 | 1.19E-06 | NA | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222926098 | 7.74E-08 | NA | mr1118_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222926098 | 8.01E-06 | NA | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222926098 | 3.02E-06 | NA | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222926098 | 8.11E-10 | NA | mr1242_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222926098 | 2.58E-09 | NA | mr1496_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |