Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0222897004:

Variant ID: vg0222897004 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22897004
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 130. )

Flanking Sequence (100 bp) in Reference Genome:


GAGTACTGCCGCTCAGATCAACAGGCCCACTGCTCAGGGGAGTTCCTCCCAGAGATTCAGCTCAGGAGCAGCGAAGAAAGTGGAGCAACCATCAGGGTGG[G/A]
CCGGATTCTAACTTCTCGTGGCCATTCGGCAATTGTCCATTCTCATTCCGAACTACTAGCTGCCCTATGCTGCAATTGCGAGTTGAAGATTGATGAGTGT

Reverse complement sequence

ACACTCATCAATCTTCAACTCGCAATTGCAGCATAGGGCAGCTAGTAGTTCGGAATGAGAATGGACAATTGCCGAATGGCCACGAGAAGTTAGAATCCGG[C/T]
CCACCCTGATGGTTGCTCCACTTTCTTCGCTGCTCCTGAGCTGAATCTCTGGGAGGAACTCCCCTGAGCAGTGGGCCTGTTGATCTGAGCGGCAGTACTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.40% 4.10% 0.51% 0.00% NA
All Indica  2759 92.30% 6.90% 0.83% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.20% 0.30% 0.50% 0.00% NA
Indica II  465 78.30% 18.30% 3.44% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 87.80% 11.70% 0.51% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222897004 G -> A LOC_Os02g37880.1 missense_variant ; p.Ala665Thr; MODERATE nonsynonymous_codon ; A665T Average:94.726; most accessible tissue: Minghui63 flag leaf, score: 96.704 unknown unknown TOLERATED 0.21
vg0222897004 G -> A LOC_Os02g37880.2 missense_variant ; p.Ala665Thr; MODERATE nonsynonymous_codon ; A665T Average:94.726; most accessible tissue: Minghui63 flag leaf, score: 96.704 unknown unknown TOLERATED 0.21
vg0222897004 G -> A LOC_Os02g37880.3 missense_variant ; p.Ala665Thr; MODERATE nonsynonymous_codon ; A665T Average:94.726; most accessible tissue: Minghui63 flag leaf, score: 96.704 unknown unknown TOLERATED 0.21

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0222897004 G A -0.11 -0.11 -0.09 -0.09 -0.08 -0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222897004 NA 1.10E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 8.73E-07 2.64E-10 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 NA 1.27E-07 mr1094 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 1.86E-06 3.74E-09 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 1.16E-06 7.09E-08 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 9.73E-06 1.39E-07 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 NA 2.86E-08 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 4.87E-06 4.57E-06 mr1146 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 NA 5.92E-06 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 NA 8.82E-06 mr1149 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 3.36E-07 2.03E-10 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 NA 1.07E-06 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 4.78E-07 2.25E-09 mr1589 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 NA 1.06E-06 mr1858 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 NA 1.04E-06 mr1859 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 5.11E-07 8.84E-08 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 2.27E-07 1.11E-10 mr1877 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 NA 3.25E-06 mr1911 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 NA 1.83E-10 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 4.78E-06 2.39E-08 mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 NA 2.92E-09 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 NA 8.73E-09 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 NA 1.04E-10 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 NA 4.16E-07 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 NA 6.66E-07 mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 NA 1.98E-06 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 1.01E-07 2.82E-11 mr1149_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 6.00E-07 7.73E-10 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 3.42E-07 1.26E-11 mr1441_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 NA 9.56E-06 mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 NA 2.65E-08 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 NA 1.17E-06 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222897004 NA 1.15E-08 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251