RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0222879623:

Variant ID: vg0222879623 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22879623
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.06, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:

AGCTTTGCTATTGGAATCTACAACCTATGATTAGCATTACTAAAAAGAAACAAAAAAGTAAATATGTCGTTAGCCGCTCTAGAGAATTCCAGTTCCAGTG[T/C]
CTAACTCATATGCAGTAATCCCAGTAGTGAAAACAACTTCGTAATAACCAACACGGAAACAAAGCAAATGCTCTTTTCCGAGATTTCTGTCACCTCGGAG

Reverse complement sequence

CTCCGAGGTGACAGAAATCTCGGAAAAGAGCATTTGCTTTGTTTCCGTGTTGGTTATTACGAAGTTGTTTTCACTACTGGGATTACTGCATATGAGTTAG[A/G]
CACTGGAACTGGAATTCTCTAGAGCGGCTAACGACATATTTACTTTTTTGTTTCTTTTTAGTAATGCTAATCATAGGTTGTAGATTCCAATAGCAAAGCT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.60%	43.00%	0.23%	0.25%	NA
All Indica	2759	84.30%	15.00%	0.29%	0.36%	NA
All Japonica	1512	2.70%	97.10%	0.07%	0.13%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	85.00%	14.50%	0.00%	0.50%	NA
Indica II	465	89.50%	9.70%	0.65%	0.22%	NA
Indica III	913	77.90%	21.60%	0.44%	0.11%	NA
Indica Intermediate	786	88.30%	10.90%	0.13%	0.64%	NA
Temperate Japonica	767	0.80%	99.20%	0.00%	0.00%	NA
Tropical Japonica	504	6.00%	93.80%	0.20%	0.00%	NA
Japonica Intermediate	241	2.10%	97.10%	0.00%	0.83%	NA
VI/Aromatic	96	10.40%	87.50%	2.08%	0.00%	NA
Intermediate	90	36.70%	63.30%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222879623	T -> DEL	N	N	silent_mutation	Average:70.569; most accessible tissue: Zhenshan97 flower, score: 87.427	N	N	N	N
vg0222879623	T -> C	LOC_Os02g37862.1	downstream_gene_variant ; 2479.0bp to feature; MODIFIER	silent_mutation	Average:70.569; most accessible tissue: Zhenshan97 flower, score: 87.427	N	N	N	N
vg0222879623	T -> C	LOC_Os02g37856.1	intron_variant ; MODIFIER	silent_mutation	Average:70.569; most accessible tissue: Zhenshan97 flower, score: 87.427	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222879623	5.24E-09	4.17E-18	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222879623	1.08E-06	3.22E-07	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222879623	1.32E-07	1.74E-34	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222879623	NA	4.78E-06	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222879623	1.38E-06	2.53E-36	mr1074	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222879623	4.89E-06	4.52E-06	mr1074	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222879623	1.25E-07	3.68E-37	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222879623	1.33E-06	1.08E-22	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222879623	1.83E-10	3.98E-23	mr1095	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222879623	4.11E-07	8.02E-07	mr1095	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 117 entries

Previous1 2 3 4 5…12Next

Search for Variation information by Variation ID:

Detailed information for vg0222879623:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact