\
| Variant ID: vg0222864514 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22864514 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.67, C: 0.33, others allele: 0.00, population size: 254. )
AAGCGAGACAAGCTGGGGGTACTGTACGCGTTGTTGCTCTTTGCTAGGGTGTTTGACAACGATGGAATGATTTCTATGCCTTGCCTCGTAGCTTTCGGCA[T/C]
GTGGTGTTGGGAACTAATTTCATACTCACGTAAAACGGAGTAGTTAATTTTAAATATGATTTTCTAAAACAACTTTCGTATAGAATTTTTTTTAGAAAAC
GTTTTCTAAAAAAAATTCTATACGAAAGTTGTTTTAGAAAATCATATTTAAAATTAACTACTCCGTTTTACGTGAGTATGAAATTAGTTCCCAACACCAC[A/G]
TGCCGAAAGCTACGAGGCAAGGCATAGAAATCATTCCATCGTTGTCAAACACCCTAGCAAAGAGCAACAACGCGTACAGTACCCCCAGCTTGTCTCGCTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.30% | 44.10% | 0.28% | 0.40% | NA |
| All Indica | 2759 | 82.50% | 16.70% | 0.22% | 0.54% | NA |
| All Japonica | 1512 | 2.60% | 97.10% | 0.13% | 0.20% | NA |
| Aus | 269 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 85.00% | 14.50% | 0.34% | 0.17% | NA |
| Indica II | 465 | 89.20% | 9.70% | 0.22% | 0.86% | NA |
| Indica III | 913 | 73.70% | 25.60% | 0.22% | 0.44% | NA |
| Indica Intermediate | 786 | 86.80% | 12.30% | 0.13% | 0.76% | NA |
| Temperate Japonica | 767 | 0.50% | 99.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 6.00% | 93.70% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.10% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 9.40% | 88.50% | 1.04% | 1.04% | NA |
| Intermediate | 90 | 28.90% | 66.70% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222864514 | T -> DEL | N | N | silent_mutation | Average:66.842; most accessible tissue: Callus, score: 89.399 | N | N | N | N |
| vg0222864514 | T -> C | LOC_Os02g37850.1 | upstream_gene_variant ; 1306.0bp to feature; MODIFIER | silent_mutation | Average:66.842; most accessible tissue: Callus, score: 89.399 | N | N | N | N |
| vg0222864514 | T -> C | LOC_Os02g37850.2 | upstream_gene_variant ; 1510.0bp to feature; MODIFIER | silent_mutation | Average:66.842; most accessible tissue: Callus, score: 89.399 | N | N | N | N |
| vg0222864514 | T -> C | LOC_Os02g37840-LOC_Os02g37850 | intergenic_region ; MODIFIER | silent_mutation | Average:66.842; most accessible tissue: Callus, score: 89.399 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222864514 | 5.33E-06 | 1.59E-09 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 6.04E-09 | 1.54E-18 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 3.76E-06 | 4.66E-07 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 5.83E-09 | 4.86E-37 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 6.66E-06 | 1.97E-07 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.57E-06 | 8.43E-37 | mr1074 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 6.01E-09 | 1.33E-39 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 1.23E-06 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 2.33E-07 | 9.22E-24 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 3.04E-06 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 8.92E-10 | 3.13E-23 | mr1095 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 9.89E-06 | 3.18E-06 | mr1095 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 3.68E-11 | NA | mr1098 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.33E-07 | 1.07E-07 | mr1098 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 6.50E-13 | NA | mr1099 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 2.73E-09 | 1.41E-10 | mr1099 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 3.82E-07 | mr1100 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 8.08E-15 | NA | mr1101 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 4.23E-10 | 1.10E-10 | mr1101 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.55E-10 | 2.43E-52 | mr1124 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 4.86E-07 | 5.24E-10 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 2.33E-31 | mr1130 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 8.75E-10 | 4.73E-22 | mr1146 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 9.67E-08 | 2.95E-08 | mr1146 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 4.82E-31 | mr1148 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 9.10E-06 | 1.18E-06 | mr1148 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 6.74E-07 | 1.76E-18 | mr1149 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 9.11E-06 | mr1149 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 4.73E-08 | 9.08E-29 | mr1150 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 7.48E-06 | mr1150 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.95E-10 | NA | mr1180 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 4.41E-08 | 5.00E-07 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 3.09E-09 | NA | mr1183 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 2.23E-06 | NA | mr1183 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.09E-08 | 5.73E-40 | mr1202 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 6.28E-06 | 2.37E-07 | mr1202 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.59E-07 | 5.73E-12 | mr1222 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 1.24E-06 | mr1222 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 8.85E-08 | NA | mr1224 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 3.32E-06 | NA | mr1224 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.93E-07 | NA | mr1225 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 5.80E-06 | NA | mr1225 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 7.58E-06 | 2.25E-08 | mr1227 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 1.78E-14 | mr1239 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 2.06E-22 | mr1254 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.07E-09 | 1.81E-20 | mr1441 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 9.07E-07 | 1.64E-07 | mr1441 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.44E-06 | 3.91E-27 | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 2.24E-08 | NA | mr1503 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 8.48E-06 | NA | mr1503 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 5.86E-10 | NA | mr1589 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 5.10E-06 | 9.14E-07 | mr1589 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 5.02E-07 | 2.79E-18 | mr1592 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 4.57E-10 | mr1595 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 4.37E-06 | mr1619 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 2.26E-08 | 1.03E-29 | mr1858 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 2.38E-06 | mr1858 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 2.25E-08 | 1.15E-29 | mr1859 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 2.41E-06 | mr1859 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.75E-10 | 7.60E-65 | mr1861 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 6.19E-06 | 5.99E-08 | mr1861 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.03E-12 | NA | mr1868 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.30E-09 | 7.76E-11 | mr1868 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.20E-09 | NA | mr1911 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.09E-06 | 1.84E-06 | mr1911 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.57E-13 | NA | mr1918 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 4.50E-11 | 1.03E-09 | mr1918 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.12E-12 | NA | mr1929 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 2.72E-11 | 3.50E-10 | mr1929 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.03E-06 | 5.16E-68 | mr1962 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 5.16E-06 | 4.97E-09 | mr1962 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 4.50E-07 | 2.19E-59 | mr1067_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.54E-07 | 1.83E-10 | mr1067_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 5.05E-11 | 1.73E-50 | mr1072_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.03E-08 | 2.93E-09 | mr1072_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 3.62E-06 | 1.11E-31 | mr1074_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 1.34E-06 | mr1074_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.73E-11 | 1.10E-51 | mr1075_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.87E-09 | 2.65E-10 | mr1075_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 3.09E-07 | 5.23E-27 | mr1077_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 8.92E-07 | NA | mr1077_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.27E-12 | 4.02E-28 | mr1095_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.28E-07 | 1.06E-08 | mr1095_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 5.53E-14 | NA | mr1098_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 6.11E-09 | 1.94E-09 | mr1098_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 3.54E-15 | 5.96E-25 | mr1099_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 2.75E-11 | 4.64E-12 | mr1099_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 8.83E-08 | mr1100_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 8.90E-16 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 5.69E-06 | NA | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 5.39E-07 | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.66E-15 | 8.76E-78 | mr1124_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 6.49E-13 | 7.76E-17 | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.49E-07 | 1.39E-22 | mr1146_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.58E-06 | 1.52E-07 | mr1146_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 1.54E-16 | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 4.91E-06 | mr1148_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 2.77E-08 | 1.43E-34 | mr1149_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.33E-07 | 8.50E-08 | mr1149_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 2.66E-13 | 4.08E-45 | mr1150_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 2.09E-08 | 1.29E-09 | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 3.27E-06 | NA | mr1180_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 2.51E-06 | NA | mr1183_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 8.70E-06 | NA | mr1183_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 2.24E-09 | 7.41E-15 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.29E-08 | 5.36E-11 | mr1222_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 2.06E-07 | mr1227_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 1.86E-19 | mr1239_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 2.21E-18 | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 6.14E-23 | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 2.45E-08 | 1.27E-34 | mr1441_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 4.73E-07 | NA | mr1441_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 2.18E-27 | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 8.61E-14 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 1.73E-20 | mr1592_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 7.11E-14 | mr1595_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 2.35E-06 | 1.05E-13 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 6.53E-06 | mr1600_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 1.02E-07 | mr1613_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 5.31E-08 | mr1619_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.90E-10 | 1.07E-59 | mr1861_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.61E-06 | 2.09E-08 | mr1861_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 1.43E-06 | mr1863_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 2.92E-12 | NA | mr1911_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 3.43E-09 | 1.40E-08 | mr1911_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 2.02E-13 | 3.02E-14 | mr1918_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 5.67E-11 | 6.90E-11 | mr1918_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.34E-08 | NA | mr1929_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 9.07E-08 | 3.77E-07 | mr1929_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 8.40E-07 | 4.80E-19 | mr1936_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | NA | 4.17E-08 | mr1936_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.56E-07 | NA | mr1962_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222864514 | 1.12E-08 | 3.82E-12 | mr1962_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |