RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0222852279:

Variant ID: vg0222852279 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22852279
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.66, C: 0.33, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

TGGTGTTGAGAGGCCATGCCATTGCCGGGCATCGAGGGCTCAGATTGGAGCATTGAGCATGGCAGCGGCTGAGGATGGAGGATGGAGAGGGTGTAGCGCA[C/T]
AAGGTGCCTCCAGCCCTTCACCGTGAACAAGACGTACGACATCACCCGGCAGTCCACGGTAGCAACGCCTCCATGCCTTGCAGTTGTGTGTTGATCTTCG

Reverse complement sequence

CGAAGATCAACACACAACTGCAAGGCATGGAGGCGTTGCTACCGTGGACTGCCGGGTGATGTCGTACGTCTTGTTCACGGTGAAGGGCTGGAGGCACCTT[G/A]
TGCGCTACACCCTCTCCATCCTCCATCCTCAGCCGCTGCCATGCTCAATGCTCCAATCTGAGCCCTCGATGCCCGGCAATGGCATGGCCTCTCAACACCA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.10%	45.30%	0.08%	0.49%	NA
All Indica	2759	80.30%	19.00%	0.07%	0.65%	NA
All Japonica	1512	2.60%	97.20%	0.07%	0.20%	NA
Aus	269	97.40%	2.60%	0.00%	0.00%	NA
Indica I	595	82.50%	17.00%	0.00%	0.50%	NA
Indica II	465	89.90%	9.50%	0.00%	0.65%	NA
Indica III	913	72.60%	26.50%	0.00%	0.88%	NA
Indica Intermediate	786	81.90%	17.30%	0.25%	0.51%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	6.00%	93.70%	0.20%	0.20%	NA
Japonica Intermediate	241	2.10%	97.10%	0.00%	0.83%	NA
VI/Aromatic	96	10.40%	87.50%	0.00%	2.08%	NA
Intermediate	90	32.20%	66.70%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222852279	C -> T	LOC_Os02g37840-LOC_Os02g37850	intergenic_region ; MODIFIER	silent_mutation	Average:65.793; most accessible tissue: Zhenshan97 young leaf, score: 80.056	N	N	N	N
vg0222852279	C -> DEL	N	N	silent_mutation	Average:65.793; most accessible tissue: Zhenshan97 young leaf, score: 80.056	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222852279	1.61E-07	NA	mr1067	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222852279	3.73E-08	3.53E-11	mr1067	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222852279	7.61E-11	6.58E-21	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222852279	2.71E-08	1.82E-09	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222852279	2.49E-09	2.88E-37	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222852279	9.26E-07	1.28E-08	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222852279	5.94E-06	3.86E-35	mr1074	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222852279	1.48E-09	3.38E-40	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222852279	1.25E-06	2.87E-08	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222852279	5.84E-08	1.63E-24	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 134 entries

Previous1 2 3 4 5…14Next

Search for Variation information by Variation ID:

Detailed information for vg0222852279:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact