\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222842247:

Variant ID: vg0222842247 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22842247
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


ATAGCTTTTGCTCTATAGATAACCATCGTAAATTCCAAATTCTTCCACATCAAAGCAAACACAAGAAGAAGGAAAAACTACATTCATTCGCTTCAAACCC[C/T]
GTCAGGAGTGGCTGTTTCGGCACAAGACAAGGAAGAAGAACTTTTTAGATTTTTCAAGGAGAGATTGGGGACCAATTTCCAAAGAACTTTAAGTCTAAAT

Reverse complement sequence

ATTTAGACTTAAAGTTCTTTGGAAATTGGTCCCCAATCTCTCCTTGAAAAATCTAAAAAGTTCTTCTTCCTTGTCTTGTGCCGAAACAGCCACTCCTGAC[G/A]
GGGTTTGAAGCGAATGAATGTAGTTTTTCCTTCTTCTTGTGTTTGCTTTGATGTGGAAGAATTTGGAATTTACGATGGTTATCTATAGAGCAAAAGCTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.70% 44.80% 1.46% 0.02% NA
All Indica  2759 23.30% 74.30% 2.36% 0.04% NA
All Japonica  1512 97.50% 2.50% 0.00% 0.00% NA
Aus  269 97.00% 2.20% 0.74% 0.00% NA
Indica I  595 18.70% 75.60% 5.71% 0.00% NA
Indica II  465 15.30% 83.20% 1.51% 0.00% NA
Indica III  913 30.70% 68.80% 0.55% 0.00% NA
Indica Intermediate  786 22.90% 74.60% 2.42% 0.13% NA
Temperate Japonica  767 99.30% 0.70% 0.00% 0.00% NA
Tropical Japonica  504 94.20% 5.80% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 72.20% 26.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222842247 C -> T LOC_Os02g37840.1 upstream_gene_variant ; 548.0bp to feature; MODIFIER silent_mutation Average:30.494; most accessible tissue: Callus, score: 60.97 N N N N
vg0222842247 C -> T LOC_Os02g37834.2 downstream_gene_variant ; 3402.0bp to feature; MODIFIER silent_mutation Average:30.494; most accessible tissue: Callus, score: 60.97 N N N N
vg0222842247 C -> T LOC_Os02g37834.4 downstream_gene_variant ; 3402.0bp to feature; MODIFIER silent_mutation Average:30.494; most accessible tissue: Callus, score: 60.97 N N N N
vg0222842247 C -> T LOC_Os02g37834.3 downstream_gene_variant ; 3402.0bp to feature; MODIFIER silent_mutation Average:30.494; most accessible tissue: Callus, score: 60.97 N N N N
vg0222842247 C -> T LOC_Os02g37834.5 downstream_gene_variant ; 3402.0bp to feature; MODIFIER silent_mutation Average:30.494; most accessible tissue: Callus, score: 60.97 N N N N
vg0222842247 C -> T LOC_Os02g37834-LOC_Os02g37840 intergenic_region ; MODIFIER silent_mutation Average:30.494; most accessible tissue: Callus, score: 60.97 N N N N
vg0222842247 C -> DEL N N silent_mutation Average:30.494; most accessible tissue: Callus, score: 60.97 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222842247 NA 1.09E-42 mr1067 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 NA 1.85E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 NA 2.55E-20 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 NA 2.55E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 NA 7.63E-40 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 NA 7.69E-07 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 NA 2.68E-12 mr1169 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 NA 1.21E-08 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 NA 1.93E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 4.35E-06 NA mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 NA 7.85E-13 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 8.24E-06 2.09E-06 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 NA 1.68E-07 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 9.49E-06 NA mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 NA 2.33E-08 mr1962 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 6.27E-07 NA mr1072_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 9.65E-06 NA mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 8.10E-08 NA mr1075_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 2.56E-06 NA mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 1.02E-08 NA mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 1.78E-07 3.18E-10 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 7.06E-06 NA mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 2.22E-06 NA mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 NA 9.92E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 NA 6.04E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 NA 4.07E-07 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 4.48E-06 NA mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 6.42E-06 NA mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 8.12E-06 1.93E-07 mr1619_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 1.37E-06 NA mr1918_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 6.02E-07 1.24E-07 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 6.78E-06 NA mr1962_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222842247 5.76E-07 4.21E-10 mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251