\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222801968:

Variant ID: vg0222801968 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22801968
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCATTTAACTTTTCTATGGACCCTTTGTATATTACTAAATCCGGTTTGAATGAATTTGTATGTACTGAACTTAGATGGACTATTTATGTAAGCTTTGCA[A/G]
ACTTGAATTTTGATGTATGGATTGTGATTGATGTTCATATATTTATCCAAATCGCCATGTGTATTTTTTTTTTGGGCGTGGAACTCATTTTTTCTGACGG

Reverse complement sequence

CCGTCAGAAAAAATGAGTTCCACGCCCAAAAAAAAAATACACATGGCGATTTGGATAAATATATGAACATCAATCACAATCCATACATCAAAATTCAAGT[T/C]
TGCAAAGCTTACATAAATAGTCCATCTAAGTTCAGTACATACAAATTCATTCAAACCGGATTTAGTAATATACAAAGGGTCCATAGAAAAGTTAAATGGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.20% 0.20% 1.29% 41.30% NA
All Indica  2759 38.00% 0.20% 1.81% 60.02% NA
All Japonica  1512 98.10% 0.10% 0.13% 1.59% NA
Aus  269 5.90% 0.40% 1.86% 91.82% NA
Indica I  595 28.90% 0.00% 1.34% 69.75% NA
Indica II  465 40.20% 0.00% 0.22% 59.57% NA
Indica III  913 39.80% 0.10% 2.85% 57.28% NA
Indica Intermediate  786 41.50% 0.50% 1.91% 56.11% NA
Temperate Japonica  767 99.60% 0.00% 0.13% 0.26% NA
Tropical Japonica  504 95.60% 0.40% 0.20% 3.77% NA
Japonica Intermediate  241 98.80% 0.00% 0.00% 1.24% NA
VI/Aromatic  96 90.60% 0.00% 0.00% 9.38% NA
Intermediate  90 76.70% 1.10% 4.44% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222801968 A -> G LOC_Os02g37790.1 upstream_gene_variant ; 3113.0bp to feature; MODIFIER silent_mutation Average:9.009; most accessible tissue: Callus, score: 46.884 N N N N
vg0222801968 A -> G LOC_Os02g37800.1 downstream_gene_variant ; 3677.0bp to feature; MODIFIER silent_mutation Average:9.009; most accessible tissue: Callus, score: 46.884 N N N N
vg0222801968 A -> G LOC_Os02g37790-LOC_Os02g37800 intergenic_region ; MODIFIER silent_mutation Average:9.009; most accessible tissue: Callus, score: 46.884 N N N N
vg0222801968 A -> DEL N N silent_mutation Average:9.009; most accessible tissue: Callus, score: 46.884 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222801968 NA 6.83E-06 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968 NA 5.47E-06 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968 9.03E-06 NA mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968 NA 1.22E-07 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968 NA 5.99E-06 mr1202 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968 NA 6.32E-08 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968 NA 8.50E-06 mr1858 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968 NA 7.07E-06 mr1859 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968 NA 4.69E-07 mr1861 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968 3.23E-06 4.57E-07 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968 NA 2.37E-06 mr1913 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968 NA 4.79E-07 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968 3.81E-06 NA mr1929 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968 9.07E-06 NA mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968 7.96E-06 1.81E-07 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968 9.21E-06 NA mr1861_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968 4.40E-06 NA mr1918_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222801968 NA 2.54E-07 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251