Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222799084:

Variant ID: vg0222799084 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22799084
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTATAATCCGATGTGACCAATCTTCCGCCCTCGATGTGCCTCTGCTCTGCACGATCTCGTCGGCCTGGCTTGGTCCACCCATACGCGCGCACTTTGTCAC[A/G]
AGCCTCTGCACAACAAGCCTATTGAGCCCCTTGTACCACGTCTGACCAATGTCCTGCCGAGCCGCCCAAAAAATCGCTGCCGCTTTGTTGCTTTGGTTCG

Reverse complement sequence

CGAACCAAAGCAACAAAGCGGCAGCGATTTTTTGGGCGGCTCGGCAGGACATTGGTCAGACGTGGTACAAGGGGCTCAATAGGCTTGTTGTGCAGAGGCT[T/C]
GTGACAAAGTGCGCGCGTATGGGTGGACCAAGCCAGGCCGACGAGATCGTGCAGAGCAGAGGCACATCGAGGGCGGAAGATTGGTCACATCGGATTATAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.70% 0.40% 11.96% 29.92% NA
All Indica  2759 38.60% 0.40% 16.06% 44.98% NA
All Japonica  1512 98.20% 0.00% 0.00% 1.79% NA
Aus  269 7.80% 2.20% 41.64% 48.33% NA
Indica I  595 30.10% 0.00% 6.05% 63.87% NA
Indica II  465 40.40% 0.00% 12.90% 46.67% NA
Indica III  913 39.80% 1.00% 27.05% 32.20% NA
Indica Intermediate  786 42.50% 0.30% 12.72% 44.53% NA
Temperate Japonica  767 99.60% 0.00% 0.00% 0.39% NA
Tropical Japonica  504 95.80% 0.00% 0.00% 4.17% NA
Japonica Intermediate  241 98.80% 0.00% 0.00% 1.24% NA
VI/Aromatic  96 90.60% 1.00% 5.21% 3.12% NA
Intermediate  90 80.00% 0.00% 5.56% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222799084 A -> G LOC_Os02g37790.1 upstream_gene_variant ; 229.0bp to feature; MODIFIER silent_mutation Average:9.692; most accessible tissue: Callus, score: 33.336 N N N N
vg0222799084 A -> G LOC_Os02g37790-LOC_Os02g37800 intergenic_region ; MODIFIER silent_mutation Average:9.692; most accessible tissue: Callus, score: 33.336 N N N N
vg0222799084 A -> DEL N N silent_mutation Average:9.692; most accessible tissue: Callus, score: 33.336 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222799084 6.12E-06 NA mr1095 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222799084 NA 7.10E-06 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222799084 NA 7.50E-10 mr1222 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222799084 4.15E-07 NA mr1225 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222799084 3.24E-06 1.37E-07 mr1225 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222799084 NA 7.72E-06 mr1589 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222799084 1.84E-06 NA mr1868 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222799084 NA 3.42E-06 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222799084 1.01E-06 NA mr1918 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222799084 3.89E-06 4.49E-08 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222799084 NA 9.39E-06 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251