Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0222778846:

Variant ID: vg0222778846 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22778846
Reference Allele: CAlternative Allele: G,T
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


ACATAATATCATGAACCTATTAGAGTAGCATATTCTAGTAGAAAATGATGAGCAATATTTTAGAAATTTAACCTTGTAAACATCTAATATTTATGATTGT[C/G,T]
GGGAATACGTTATTGTGGCTAACAGCTATAGATGGAAGATGGTCAAATGAGCTATCTGGCCCGATTACAACCGGGCTCAGGTCCAAGATCAGTCGGAACG

Reverse complement sequence

CGTTCCGACTGATCTTGGACCTGAGCCCGGTTGTAATCGGGCCAGATAGCTCATTTGACCATCTTCCATCTATAGCTGTTAGCCACAATAACGTATTCCC[G/C,A]
ACAATCATAAATATTAGATGTTTACAAGGTTAAATTTCTAAAATATTGCTCATCATTTTCTACTAGAATATGCTACTCTAATAGGTTCATGATATTATGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.80% 10.10% 3.41% 42.68% NA
All Indica  2759 34.90% 1.00% 2.07% 61.98% NA
All Japonica  1512 63.00% 29.00% 6.42% 1.65% NA
Aus  269 3.30% 0.00% 1.86% 94.80% NA
Indica I  595 18.30% 2.20% 3.87% 75.63% NA
Indica II  465 37.40% 0.40% 2.37% 59.78% NA
Indica III  913 43.30% 0.00% 0.33% 56.41% NA
Indica Intermediate  786 36.40% 1.70% 2.54% 59.41% NA
Temperate Japonica  767 38.10% 51.90% 9.78% 0.26% NA
Tropical Japonica  504 91.70% 2.20% 2.18% 3.97% NA
Japonica Intermediate  241 82.20% 12.00% 4.56% 1.24% NA
VI/Aromatic  96 89.60% 1.00% 0.00% 9.38% NA
Intermediate  90 67.80% 10.00% 2.22% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222778846 C -> G LOC_Os02g37750.1 upstream_gene_variant ; 362.0bp to feature; MODIFIER silent_mutation Average:12.181; most accessible tissue: Callus, score: 62.225 N N N N
vg0222778846 C -> G LOC_Os02g37730.1 downstream_gene_variant ; 4588.0bp to feature; MODIFIER silent_mutation Average:12.181; most accessible tissue: Callus, score: 62.225 N N N N
vg0222778846 C -> G LOC_Os02g37740.1 downstream_gene_variant ; 1924.0bp to feature; MODIFIER silent_mutation Average:12.181; most accessible tissue: Callus, score: 62.225 N N N N
vg0222778846 C -> G LOC_Os02g37760.1 downstream_gene_variant ; 3904.0bp to feature; MODIFIER silent_mutation Average:12.181; most accessible tissue: Callus, score: 62.225 N N N N
vg0222778846 C -> G LOC_Os02g37750-LOC_Os02g37760 intergenic_region ; MODIFIER silent_mutation Average:12.181; most accessible tissue: Callus, score: 62.225 N N N N
vg0222778846 C -> T LOC_Os02g37750.1 upstream_gene_variant ; 362.0bp to feature; MODIFIER N Average:12.181; most accessible tissue: Callus, score: 62.225 N N N N
vg0222778846 C -> T LOC_Os02g37730.1 downstream_gene_variant ; 4588.0bp to feature; MODIFIER N Average:12.181; most accessible tissue: Callus, score: 62.225 N N N N
vg0222778846 C -> T LOC_Os02g37740.1 downstream_gene_variant ; 1924.0bp to feature; MODIFIER N Average:12.181; most accessible tissue: Callus, score: 62.225 N N N N
vg0222778846 C -> T LOC_Os02g37760.1 downstream_gene_variant ; 3904.0bp to feature; MODIFIER N Average:12.181; most accessible tissue: Callus, score: 62.225 N N N N
vg0222778846 C -> T LOC_Os02g37750-LOC_Os02g37760 intergenic_region ; MODIFIER N Average:12.181; most accessible tissue: Callus, score: 62.225 N N N N
vg0222778846 C -> DEL N N silent_mutation Average:12.181; most accessible tissue: Callus, score: 62.225 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222778846 1.93E-06 NA mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222778846 4.18E-06 4.18E-06 mr1166 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222778846 1.16E-08 NA mr1210 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222778846 6.23E-06 NA mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222778846 1.87E-08 NA mr1305 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222778846 8.39E-06 NA mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222778846 5.00E-06 NA mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222778846 5.73E-07 NA mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222778846 2.21E-06 NA mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222778846 1.02E-09 NA mr1586 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222778846 4.14E-06 NA mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222778846 NA 1.64E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222778846 3.72E-06 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222778846 3.44E-06 NA mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222778846 NA 3.97E-08 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222778846 NA 2.68E-06 mr1977_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251