\
| Variant ID: vg0222778319 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22778319 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CGCCGAGAGGTCCGAGCTGTTCTCCCACAGCCCGAACCACCCCTTCCACTTCAACGTGCCGCACAGCTCGGCACCGATGGCTGGTATGCATCAGTGAGCC[A/G]
CGCCTCCAGGTTGCTGCAGCTAGCCCCAGGTACAACGAAGATCGGGTGGAGCTCGCCGGCGCCGACGCCGGCATCGTTTGGCCTGTGGTGGCTTGGCCAG
CTGGCCAAGCCACCACAGGCCAAACGATGCCGGCGTCGGCGCCGGCGAGCTCCACCCGATCTTCGTTGTACCTGGGGCTAGCTGCAGCAACCTGGAGGCG[T/C]
GGCTCACTGATGCATACCAGCCATCGGTGCCGAGCTGTGCGGCACGTTGAAGTGGAAGGGGTGGTTCGGGCTGTGGGAGAACAGCTCGGACCTCTCGGCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 44.10% | 12.60% | 1.40% | 41.87% | NA |
| All Indica | 2759 | 31.00% | 6.40% | 1.88% | 60.71% | NA |
| All Japonica | 1512 | 76.90% | 20.90% | 0.46% | 1.72% | NA |
| Aus | 269 | 3.30% | 1.50% | 1.86% | 93.31% | NA |
| Indica I | 595 | 12.90% | 10.60% | 2.02% | 74.45% | NA |
| Indica II | 465 | 38.70% | 0.20% | 1.08% | 60.00% | NA |
| Indica III | 913 | 36.70% | 6.90% | 2.08% | 54.33% | NA |
| Indica Intermediate | 786 | 33.50% | 6.40% | 2.04% | 58.14% | NA |
| Temperate Japonica | 767 | 92.40% | 6.60% | 0.65% | 0.26% | NA |
| Tropical Japonica | 504 | 61.70% | 33.70% | 0.40% | 4.17% | NA |
| Japonica Intermediate | 241 | 59.30% | 39.40% | 0.00% | 1.24% | NA |
| VI/Aromatic | 96 | 7.30% | 82.30% | 1.04% | 9.38% | NA |
| Intermediate | 90 | 55.60% | 23.30% | 1.11% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222778319 | A -> G | LOC_Os02g37750.1 | missense_variant ; p.Trp56Arg; MODERATE | nonsynonymous_codon ; W56R | Average:12.559; most accessible tissue: Callus, score: 72.278 | benign |
-0.338 |
TOLERATED | 1.00 |
| vg0222778319 | A -> DEL | LOC_Os02g37750.1 | N | frameshift_variant | Average:12.559; most accessible tissue: Callus, score: 72.278 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222778319 | 5.86E-06 | NA | mr1918 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222778319 | 2.80E-06 | NA | mr1067_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222778319 | 6.01E-08 | NA | mr1072_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222778319 | 1.34E-08 | NA | mr1075_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222778319 | 5.02E-07 | NA | mr1077_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222778319 | 2.32E-06 | NA | mr1124_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222778319 | 4.49E-07 | NA | mr1124_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222778319 | 2.14E-07 | NA | mr1149_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222778319 | 3.35E-07 | NA | mr1441_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222778319 | 2.36E-06 | NA | mr1918_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222778319 | 2.84E-06 | NA | mr1962_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |