| Variant ID: vg0222765370 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22765370 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CCGACCGGACGAGACGCACTGTCTCATCCGTGTCGTTTGAGAAGCACTCCCTTAGTTGTTTCGGAAAAGAGTTTAAATAAAATCAATCGCAAAAACAACA[T/G]
CCTTTCTTTGAAGCCTGCATTAAACACTTATTTCCCATGGCTTGCTGAGTACTCCTGTACTCACCCTTGCTCTATATAAATAATCCCCCCCAGTTGCTGA
TCAGCAACTGGGGGGGATTATTTATATAGAGCAAGGGTGAGTACAGGAGTACTCAGCAAGCCATGGGAAATAAGTGTTTAATGCAGGCTTCAAAGAAAGG[A/C]
TGTTGTTTTTGCGATTGATTTTATTTAAACTCTTTTCCGAAACAACTAAGGGAGTGCTTCTCAAACGACACGGATGAGACAGTGCGTCTCGTCCGGTCGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.90% | 0.10% | 5.06% | 35.97% | NA |
| All Indica | 2759 | 39.50% | 0.20% | 7.61% | 52.66% | NA |
| All Japonica | 1512 | 98.30% | 0.00% | 0.00% | 1.72% | NA |
| Aus | 269 | 17.10% | 0.00% | 10.04% | 72.86% | NA |
| Indica I | 595 | 25.90% | 0.00% | 4.37% | 69.75% | NA |
| Indica II | 465 | 43.90% | 0.20% | 6.24% | 49.68% | NA |
| Indica III | 913 | 42.30% | 0.20% | 11.28% | 46.22% | NA |
| Indica Intermediate | 786 | 44.10% | 0.30% | 6.62% | 48.98% | NA |
| Temperate Japonica | 767 | 99.70% | 0.00% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 95.60% | 0.00% | 0.00% | 4.37% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 91.70% | 0.00% | 0.00% | 8.33% | NA |
| Intermediate | 90 | 78.90% | 0.00% | 2.22% | 18.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222765370 | T -> G | LOC_Os02g37720.1 | upstream_gene_variant ; 1864.0bp to feature; MODIFIER | silent_mutation | Average:7.871; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| vg0222765370 | T -> G | LOC_Os02g37710.1 | downstream_gene_variant ; 392.0bp to feature; MODIFIER | silent_mutation | Average:7.871; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| vg0222765370 | T -> G | LOC_Os02g37700-LOC_Os02g37710 | intergenic_region ; MODIFIER | silent_mutation | Average:7.871; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| vg0222765370 | T -> DEL | N | N | silent_mutation | Average:7.871; most accessible tissue: Zhenshan97 panicle, score: 16.188 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222765370 | NA | 5.04E-14 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222765370 | NA | 4.47E-07 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222765370 | NA | 2.23E-08 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222765370 | 2.60E-06 | NA | mr1074 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222765370 | NA | 6.00E-08 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222765370 | NA | 3.62E-06 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222765370 | 3.08E-06 | NA | mr1095 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222765370 | 7.04E-07 | 7.33E-10 | mr1095 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222765370 | 3.87E-07 | NA | mr1098 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222765370 | 8.69E-09 | 5.66E-12 | mr1098 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/