| Variant ID: vg0222739148 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22739148 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 245. )
CTCACGGATCGGAAAGGCTAAGTCCGAATATATCACTAGTAGAGAAACAATTTTCTTGGACGAGGAGCTATTTAGTTTACAGACGGACCGTTTTCACGTC[C/T]
GCACGCAAAAATCGGCCTCCCATTTTCGTGTACGGGCCTGTAAAAAACCTGCCTACAAGTTTATCATTCCTTATCTTTTTCCTCCTCAACACTTCAAAAT
ATTTTGAAGTGTTGAGGAGGAAAAAGATAAGGAATGATAAACTTGTAGGCAGGTTTTTTACAGGCCCGTACACGAAAATGGGAGGCCGATTTTTGCGTGC[G/A]
GACGTGAAAACGGTCCGTCTGTAAACTAAATAGCTCCTCGTCCAAGAAAATTGTTTCTCTACTAGTGATATATTCGGACTTAGCCTTTCCGATCCGTGAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.60% | 4.40% | 0.04% | 0.93% | NA |
| All Indica | 2759 | 97.00% | 1.40% | 0.04% | 1.56% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 54.30% | 45.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.30% | 1.10% | 0.00% | 4.60% | NA |
| Indica Intermediate | 786 | 97.20% | 2.50% | 0.13% | 0.13% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 55.20% | 44.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222739148 | C -> T | LOC_Os02g37680.1 | upstream_gene_variant ; 494.0bp to feature; MODIFIER | silent_mutation | Average:72.191; most accessible tissue: Zhenshan97 young leaf, score: 85.886 | N | N | N | N |
| vg0222739148 | C -> T | LOC_Os02g37694.1 | upstream_gene_variant ; 4602.0bp to feature; MODIFIER | silent_mutation | Average:72.191; most accessible tissue: Zhenshan97 young leaf, score: 85.886 | N | N | N | N |
| vg0222739148 | C -> T | LOC_Os02g37690.1 | downstream_gene_variant ; 2215.0bp to feature; MODIFIER | silent_mutation | Average:72.191; most accessible tissue: Zhenshan97 young leaf, score: 85.886 | N | N | N | N |
| vg0222739148 | C -> T | LOC_Os02g37680-LOC_Os02g37690 | intergenic_region ; MODIFIER | silent_mutation | Average:72.191; most accessible tissue: Zhenshan97 young leaf, score: 85.886 | N | N | N | N |
| vg0222739148 | C -> DEL | N | N | silent_mutation | Average:72.191; most accessible tissue: Zhenshan97 young leaf, score: 85.886 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222739148 | 8.21E-06 | NA | mr1095 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222739148 | 4.36E-09 | NA | mr1098 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222739148 | 1.70E-07 | NA | mr1099 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222739148 | 1.76E-08 | 3.76E-26 | mr1101 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222739148 | 7.90E-17 | 9.33E-29 | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222739148 | 1.59E-18 | 2.94E-31 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222739148 | 1.79E-18 | 5.20E-27 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222739148 | 6.36E-18 | 2.27E-33 | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222739148 | 5.90E-18 | NA | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222739148 | 2.19E-15 | 3.56E-30 | mr1119 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/