\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222739148:

Variant ID: vg0222739148 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22739148
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


CTCACGGATCGGAAAGGCTAAGTCCGAATATATCACTAGTAGAGAAACAATTTTCTTGGACGAGGAGCTATTTAGTTTACAGACGGACCGTTTTCACGTC[C/T]
GCACGCAAAAATCGGCCTCCCATTTTCGTGTACGGGCCTGTAAAAAACCTGCCTACAAGTTTATCATTCCTTATCTTTTTCCTCCTCAACACTTCAAAAT

Reverse complement sequence

ATTTTGAAGTGTTGAGGAGGAAAAAGATAAGGAATGATAAACTTGTAGGCAGGTTTTTTACAGGCCCGTACACGAAAATGGGAGGCCGATTTTTGCGTGC[G/A]
GACGTGAAAACGGTCCGTCTGTAAACTAAATAGCTCCTCGTCCAAGAAAATTGTTTCTCTACTAGTGATATATTCGGACTTAGCCTTTCCGATCCGTGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.60% 4.40% 0.04% 0.93% NA
All Indica  2759 97.00% 1.40% 0.04% 1.56% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 54.30% 45.40% 0.37% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 94.30% 1.10% 0.00% 4.60% NA
Indica Intermediate  786 97.20% 2.50% 0.13% 0.13% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 55.20% 44.80% 0.00% 0.00% NA
Intermediate  90 95.60% 3.30% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222739148 C -> T LOC_Os02g37680.1 upstream_gene_variant ; 494.0bp to feature; MODIFIER silent_mutation Average:72.191; most accessible tissue: Zhenshan97 young leaf, score: 85.886 N N N N
vg0222739148 C -> T LOC_Os02g37694.1 upstream_gene_variant ; 4602.0bp to feature; MODIFIER silent_mutation Average:72.191; most accessible tissue: Zhenshan97 young leaf, score: 85.886 N N N N
vg0222739148 C -> T LOC_Os02g37690.1 downstream_gene_variant ; 2215.0bp to feature; MODIFIER silent_mutation Average:72.191; most accessible tissue: Zhenshan97 young leaf, score: 85.886 N N N N
vg0222739148 C -> T LOC_Os02g37680-LOC_Os02g37690 intergenic_region ; MODIFIER silent_mutation Average:72.191; most accessible tissue: Zhenshan97 young leaf, score: 85.886 N N N N
vg0222739148 C -> DEL N N silent_mutation Average:72.191; most accessible tissue: Zhenshan97 young leaf, score: 85.886 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222739148 8.21E-06 NA mr1095 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 4.36E-09 NA mr1098 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 1.70E-07 NA mr1099 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 1.76E-08 3.76E-26 mr1101 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 7.90E-17 9.33E-29 mr1113 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 1.59E-18 2.94E-31 mr1114 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 1.79E-18 5.20E-27 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 6.36E-18 2.27E-33 mr1117 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 5.90E-18 NA mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 2.19E-15 3.56E-30 mr1119 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 4.87E-13 3.96E-27 mr1120 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 1.22E-21 5.48E-35 mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 1.81E-06 NA mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 1.15E-10 2.60E-20 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 2.19E-23 6.11E-28 mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 4.52E-15 6.61E-32 mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 1.99E-10 NA mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 1.77E-22 2.94E-27 mr1496 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 5.55E-06 NA mr1589 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 1.17E-08 NA mr1858 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 1.14E-08 NA mr1859 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 7.29E-06 NA mr1868 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 6.11E-14 6.40E-25 mr1917 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 3.41E-14 2.07E-21 mr1936 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 1.69E-07 6.96E-24 mr1961 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 2.16E-08 NA mr1098_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 9.13E-09 8.92E-24 mr1099_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 6.19E-22 1.39E-39 mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 2.26E-22 3.65E-38 mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 1.72E-20 3.92E-39 mr1117_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 6.79E-20 9.17E-17 mr1118_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 1.43E-20 6.52E-40 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 1.52E-17 8.23E-42 mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 1.24E-24 3.76E-41 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 1.31E-18 7.12E-31 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 4.38E-27 1.15E-34 mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 4.73E-19 1.82E-41 mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 NA 1.63E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 NA 5.20E-08 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 9.53E-14 NA mr1495_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 1.25E-27 1.38E-30 mr1496_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 2.58E-16 9.57E-25 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222739148 3.05E-10 6.91E-26 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251