| Variant ID: vg0222738038 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22738038 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 291. )
GTGTCAGAAAACCCATTCTACTAGGAAATCTGGAGTCCGTAAGTAAATACTTTCCTACAAAACATATGATAAACATAATTGCATAAATGCTCAATTATTA[G/A]
GAGTGGTAATAAATGCTCTCTTATTTCAAAATTTTGGATAGTCACTTTGCGGTAACCTAGGAAAATTGTCCGGATAATATTGCATTGCTTGATTCAAAAC
GTTTTGAATCAAGCAATGCAATATTATCCGGACAATTTTCCTAGGTTACCGCAAAGTGACTATCCAAAATTTTGAAATAAGAGAGCATTTATTACCACTC[C/T]
TAATAATTGAGCATTTATGCAATTATGTTTATCATATGTTTTGTAGGAAAGTATTTACTTACGGACTCCAGATTTCCTAGTAGAATGGGTTTTCTGACAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.80% | 37.40% | 0.21% | 0.59% | NA |
| All Indica | 2759 | 41.80% | 57.20% | 0.18% | 0.87% | NA |
| All Japonica | 1512 | 97.90% | 1.80% | 0.20% | 0.07% | NA |
| Aus | 269 | 49.80% | 50.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 19.80% | 78.50% | 0.00% | 1.68% | NA |
| Indica II | 465 | 60.60% | 38.50% | 0.22% | 0.65% | NA |
| Indica III | 913 | 43.50% | 56.00% | 0.11% | 0.44% | NA |
| Indica Intermediate | 786 | 45.20% | 53.60% | 0.38% | 0.89% | NA |
| Temperate Japonica | 767 | 99.60% | 0.30% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 95.40% | 4.40% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.90% | 1.20% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 8.30% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 77.80% | 20.00% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222738038 | G -> A | LOC_Os02g37654.1 | upstream_gene_variant ; 4786.0bp to feature; MODIFIER | silent_mutation | Average:53.869; most accessible tissue: Minghui63 young leaf, score: 76.385 | N | N | N | N |
| vg0222738038 | G -> A | LOC_Os02g37690.1 | downstream_gene_variant ; 3325.0bp to feature; MODIFIER | silent_mutation | Average:53.869; most accessible tissue: Minghui63 young leaf, score: 76.385 | N | N | N | N |
| vg0222738038 | G -> A | LOC_Os02g37680.1 | intron_variant ; MODIFIER | silent_mutation | Average:53.869; most accessible tissue: Minghui63 young leaf, score: 76.385 | N | N | N | N |
| vg0222738038 | G -> DEL | N | N | silent_mutation | Average:53.869; most accessible tissue: Minghui63 young leaf, score: 76.385 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222738038 | 2.47E-10 | 6.16E-44 | mr1067 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222738038 | 8.76E-15 | 1.85E-21 | mr1067 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222738038 | 4.98E-26 | 4.06E-47 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222738038 | 6.83E-28 | 6.59E-42 | mr1069 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222738038 | NA | 9.71E-07 | mr1071 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222738038 | 5.39E-20 | 5.97E-59 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222738038 | 4.71E-21 | 2.90E-37 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222738038 | 3.65E-14 | 1.64E-41 | mr1074 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222738038 | 2.66E-19 | 4.35E-28 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222738038 | 8.60E-18 | 9.28E-55 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/