| Variant ID: vg0222730075 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22730075 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.12, others allele: 0.00, population size: 101. )
AGGCACGAGAGGGGACTGCCCGCTGCCTTACGAGGAGTGGGGGTGAAACCTGAGGTGTGGTGTGCTTGGTTGGAGGGGGTTATGCGAAGGGTCCTGTCAC[A/G]
GCCTCTTTCCGGTATGTCGTGGTGGCATGCCGGCGCACGGAAACGTGTCGTGGGGCTGTGTCTTGTGGGTACAGTTGTACACCTCTGATCAGAGTAAAAC
GTTTTACTCTGATCAGAGGTGTACAACTGTACCCACAAGACACAGCCCCACGACACGTTTCCGTGCGCCGGCATGCCACCACGACATACCGGAAAGAGGC[T/C]
GTGACAGGACCCTTCGCATAACCCCCTCCAACCAAGCACACCACACCTCAGGTTTCACCCCCACTCCTCGTAAGGCAGCGGGCAGTCCCCTCTCGTGCCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.50% | 1.20% | 14.35% | 24.90% | NA |
| All Indica | 2759 | 43.60% | 0.30% | 17.47% | 38.67% | NA |
| All Japonica | 1512 | 97.90% | 0.30% | 0.53% | 1.19% | NA |
| Aus | 269 | 5.90% | 0.40% | 66.17% | 27.51% | NA |
| Indica I | 595 | 27.70% | 0.00% | 18.66% | 53.61% | NA |
| Indica II | 465 | 62.60% | 0.00% | 11.83% | 25.59% | NA |
| Indica III | 913 | 41.50% | 0.30% | 20.04% | 38.12% | NA |
| Indica Intermediate | 786 | 46.70% | 0.60% | 16.92% | 35.75% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 95.40% | 0.20% | 1.39% | 2.98% | NA |
| Japonica Intermediate | 241 | 97.50% | 1.20% | 0.41% | 0.83% | NA |
| VI/Aromatic | 96 | 47.90% | 42.70% | 5.21% | 4.17% | NA |
| Intermediate | 90 | 76.70% | 2.20% | 5.56% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222730075 | A -> G | LOC_Os02g37654.1 | intron_variant ; MODIFIER | silent_mutation | Average:31.008; most accessible tissue: Minghui63 root, score: 41.911 | N | N | N | N |
| vg0222730075 | A -> DEL | N | N | silent_mutation | Average:31.008; most accessible tissue: Minghui63 root, score: 41.911 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222730075 | 4.20E-06 | 1.67E-13 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222730075 | 3.89E-07 | 6.76E-12 | mr1069 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222730075 | NA | 7.14E-09 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222730075 | NA | 7.91E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222730075 | NA | 1.16E-07 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222730075 | NA | 4.57E-08 | mr1077 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222730075 | NA | 2.02E-06 | mr1098 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222730075 | NA | 2.06E-06 | mr1099 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222730075 | NA | 3.28E-07 | mr1101 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222730075 | NA | 5.30E-08 | mr1124 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/