| Variant ID: vg0222729493 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22729493 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.00, others allele: 0.00, population size: 268. )
AAGAAGCAAGGCAAGTCACACATTTCCCTTGAGCATGTTGATCCCAATTTACTAATGTTTTACCGTTTACAAATAAATATGCATGTTTTGCTAATTACAT[T/G]
GGATCCGGGTATTACCTATCTGCTTGCTTGTGCCATGTTTACTTGATATCTGTTCTTTGTTAACCTTGGGTAATGAATCGACTAGCTCATGTTACTTATG
CATAAGTAACATGAGCTAGTCGATTCATTACCCAAGGTTAACAAAGAACAGATATCAAGTAAACATGGCACAAGCAAGCAGATAGGTAATACCCGGATCC[A/C]
ATGTAATTAGCAAAACATGCATATTTATTTGTAAACGGTAAAACATTAGTAAATTGGGATCAACATGCTCAAGGGAAATGTGTGACTTGCCTTGCTTCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.30% | 44.50% | 2.20% | 0.00% | NA |
| All Indica | 2759 | 63.70% | 34.70% | 1.67% | 0.00% | NA |
| All Japonica | 1512 | 24.60% | 72.00% | 3.44% | 0.00% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.70% | 7.90% | 4.37% | 0.00% | NA |
| Indica II | 465 | 40.20% | 58.90% | 0.86% | 0.00% | NA |
| Indica III | 913 | 63.50% | 36.30% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 59.50% | 38.70% | 1.78% | 0.00% | NA |
| Temperate Japonica | 767 | 8.60% | 85.80% | 5.61% | 0.00% | NA |
| Tropical Japonica | 504 | 46.20% | 52.60% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 30.30% | 68.50% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 5.20% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 41.10% | 54.40% | 4.44% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222729493 | T -> G | LOC_Os02g37654.1 | intron_variant ; MODIFIER | silent_mutation | Average:30.963; most accessible tissue: Minghui63 young leaf, score: 49.581 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222729493 | 3.37E-10 | 2.88E-18 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222729493 | 3.95E-12 | 1.07E-34 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222729493 | 1.62E-19 | 1.32E-33 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222729493 | 8.12E-09 | 3.19E-32 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222729493 | 6.91E-16 | 3.60E-30 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222729493 | 8.37E-10 | NA | mr1074 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222729493 | 5.59E-17 | 1.42E-26 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222729493 | 1.63E-07 | 1.06E-28 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222729493 | 7.45E-15 | 2.47E-26 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222729493 | 3.31E-07 | 6.90E-26 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/