| Variant ID: vg0222724011 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22724011 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.57, C: 0.43, others allele: 0.00, population size: 105. )
TTTGTAATAATTTAAGAGTTCTATTTTTCTTAAGGTATCTTAAAAATCCATTCACAAACTTTTGAGTAGGAGATGGATTAAATACTTACGACATTTGAAT[T/C]
ATGTTTTTTTCTCGAGTAAATAATAAACTATTGCTTGAAGTATGGCTACAAATGAAAAATGTAAGAGCAAGATAATCAAAATTCTTGTGATTAAATCGTC
GACGATTTAATCACAAGAATTTTGATTATCTTGCTCTTACATTTTTCATTTGTAGCCATACTTCAAGCAATAGTTTATTATTTACTCGAGAAAAAAACAT[A/G]
ATTCAAATGTCGTAAGTATTTAATCCATCTCCTACTCAAAAGTTTGTGAATGGATTTTTAAGATACCTTAAGAAAAATAGAACTCTTAAATTATTACAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.40% | 42.30% | 0.34% | 0.00% | NA |
| All Indica | 2759 | 38.90% | 60.60% | 0.51% | 0.00% | NA |
| All Japonica | 1512 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 2.60% | 97.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 19.80% | 79.70% | 0.50% | 0.00% | NA |
| Indica II | 465 | 58.70% | 40.20% | 1.08% | 0.00% | NA |
| Indica III | 913 | 38.00% | 61.80% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 42.50% | 57.00% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 86.50% | 11.50% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 26.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222724011 | T -> C | LOC_Os02g37654.1 | intron_variant ; MODIFIER | silent_mutation | Average:42.036; most accessible tissue: Callus, score: 72.256 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222724011 | 6.09E-06 | NA | mr1063 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222724011 | 2.78E-15 | 2.58E-45 | mr1067 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222724011 | 4.18E-14 | 8.14E-24 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222724011 | 6.89E-32 | 4.59E-56 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222724011 | 6.41E-25 | 7.67E-41 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222724011 | NA | 1.77E-06 | mr1071 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222724011 | 6.93E-26 | 5.56E-65 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222724011 | 3.48E-21 | 2.62E-38 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222724011 | 1.90E-21 | 2.23E-60 | mr1074 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222724011 | 9.65E-23 | 8.63E-32 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/