Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222722554:

Variant ID: vg0222722554 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22722554
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TTGCTCAATCCACCGGTTGGTTTTGGAGACAACGTGTTTTTACCATAGCTTTGTCAGATTGTTTTTTAGGTAGGCTGGTCAGAGTTGAGTAACCTATGGT[C/T]
GGACCGGCCGGGCCTCGGTCAGACCGACCCTAGTAGGTCTGATAGACTGTCAGATGTGTGTTCAATTGGTTTTTGAGGTTGAGGTATGATTTGATCTTTT

Reverse complement sequence

AAAAGATCAAATCATACCTCAACCTCAAAAACCAATTGAACACACATCTGACAGTCTATCAGACCTACTAGGGTCGGTCTGACCGAGGCCCGGCCGGTCC[G/A]
ACCATAGGTTACTCAACTCTGACCAGCCTACCTAAAAAACAATCTGACAAAGCTATGGTAAAAACACGTTGTCTCCAAAACCAACCGGTGGATTGAGCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.10% 4.30% 0.63% 0.00% NA
All Indica  2759 96.40% 2.70% 0.91% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.07% 0.00% NA
Aus  269 56.10% 42.40% 1.49% 0.00% NA
Indica I  595 98.00% 0.20% 1.85% 0.00% NA
Indica II  465 96.10% 2.60% 1.29% 0.00% NA
Indica III  913 96.10% 3.90% 0.00% 0.00% NA
Indica Intermediate  786 95.70% 3.30% 1.02% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222722554 C -> T LOC_Os02g37654.1 downstream_gene_variant ; 105.0bp to feature; MODIFIER silent_mutation Average:64.345; most accessible tissue: Zhenshan97 young leaf, score: 94.981 N N N N
vg0222722554 C -> T LOC_Os02g37630-LOC_Os02g37654 intergenic_region ; MODIFIER silent_mutation Average:64.345; most accessible tissue: Zhenshan97 young leaf, score: 94.981 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0222722554 C T -0.01 -0.02 -0.01 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222722554 1.21E-09 NA mr1113 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 1.85E-14 NA mr1114 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 1.40E-12 NA mr1116 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 7.73E-11 NA mr1117 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 3.37E-11 NA mr1118 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 8.89E-09 NA mr1119 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 3.70E-12 NA mr1123 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 2.92E-06 NA mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 1.34E-15 NA mr1242 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 7.47E-08 NA mr1247 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 6.11E-06 NA mr1495 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 3.00E-14 NA mr1496 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 2.85E-08 NA mr1917 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 1.77E-06 NA mr1936 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 5.27E-11 NA mr1113_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 5.34E-11 NA mr1114_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 2.41E-09 NA mr1117_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 2.48E-12 NA mr1118_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 3.00E-09 NA mr1119_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 2.24E-06 NA mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 1.20E-11 NA mr1123_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 1.86E-09 NA mr1240_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 5.12E-16 NA mr1242_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 1.31E-07 NA mr1247_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 1.84E-06 NA mr1495_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 2.16E-15 NA mr1496_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222722554 7.51E-07 NA mr1936_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251