| Variant ID: vg0222717674 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22717674 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTGTTTGAAGACAGTAGGTAGTAGGTAGTATAGTCGGAGTTTTTTTTGGTCCGATAGCATCCGATCAGACATAGTGGCGGCCCTATGGTGATACTCTCTC[C/T]
GTCTCAAAATGTAAGCATTTTTTTAGCTATGACCTAGATTCATAGCCTAAAGTTGCTATATTTTGGAACGGAGGTAGTAGTTCTTTTCTTGACTGTGTAC
GTACACAGTCAAGAAAAGAACTACTACCTCCGTTCCAAAATATAGCAACTTTAGGCTATGAATCTAGGTCATAGCTAAAAAAATGCTTACATTTTGAGAC[G/A]
GAGAGAGTATCACCATAGGGCCGCCACTATGTCTGATCGGATGCTATCGGACCAAAAAAAACTCCGACTATACTACCTACTACCTACTGTCTTCAAACAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.70% | 2.30% | 0.95% | 0.00% | NA |
| All Indica | 2759 | 97.80% | 1.50% | 0.65% | 0.00% | NA |
| All Japonica | 1512 | 93.90% | 4.40% | 1.72% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.80% | 2.00% | 1.18% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.50% | 0.40% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.50% | 3.30% | 1.15% | 0.00% | NA |
| Temperate Japonica | 767 | 96.10% | 2.30% | 1.56% | 0.00% | NA |
| Tropical Japonica | 504 | 96.80% | 2.60% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 80.90% | 14.50% | 4.56% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222717674 | C -> T | LOC_Os02g37630.1 | upstream_gene_variant ; 4439.0bp to feature; MODIFIER | silent_mutation | Average:55.676; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| vg0222717674 | C -> T | LOC_Os02g37654.1 | downstream_gene_variant ; 4985.0bp to feature; MODIFIER | silent_mutation | Average:55.676; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| vg0222717674 | C -> T | LOC_Os02g37630-LOC_Os02g37654 | intergenic_region ; MODIFIER | silent_mutation | Average:55.676; most accessible tissue: Zhenshan97 flag leaf, score: 63.67 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222717674 | NA | 6.67E-06 | mr1113 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222717674 | NA | 6.08E-08 | mr1114 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222717674 | NA | 3.97E-06 | mr1116 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222717674 | 2.70E-07 | 1.41E-10 | mr1117 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222717674 | NA | 2.08E-06 | mr1118 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222717674 | NA | 4.46E-07 | mr1119 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222717674 | NA | 9.36E-06 | mr1120 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222717674 | NA | 5.32E-08 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222717674 | 1.25E-07 | 6.14E-10 | mr1240 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222717674 | NA | 3.30E-07 | mr1242 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/