\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222716080:

Variant ID: vg0222716080 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22716080
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTACTCCCTCCGTCTAGATTCATTAGCATCAATATGAATGTGGGAAATGCTAGAATGACTTACATTATGAAACGGAGGGAGTACCTATATTATATACATA[T/C]
TTTTTTTAAAAAAGAAAGCATAAGAAGTTTTTGAGAAAATTCTATCACAAACCCATAATCTGAATTCCCGATCAAACCCAAGGTGGAATATCACATAAAA

Reverse complement sequence

TTTTATGTGATATTCCACCTTGGGTTTGATCGGGAATTCAGATTATGGGTTTGTGATAGAATTTTCTCAAAAACTTCTTATGCTTTCTTTTTTAAAAAAA[A/G]
TATGTATATAATATAGGTACTCCCTCCGTTTCATAATGTAAGTCATTCTAGCATTTCCCACATTCATATTGATGCTAATGAATCTAGACGGAGGGAGTAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.00% 32.50% 3.58% 5.92% NA
All Indica  2759 38.70% 46.20% 5.15% 9.97% NA
All Japonica  1512 97.90% 1.70% 0.20% 0.20% NA
Aus  269 14.90% 79.60% 5.58% 0.00% NA
Indica I  595 19.70% 58.70% 13.11% 8.57% NA
Indica II  465 59.40% 33.10% 3.44% 4.09% NA
Indica III  913 37.80% 48.80% 1.20% 12.16% NA
Indica Intermediate  786 42.00% 41.30% 4.71% 11.96% NA
Temperate Japonica  767 99.60% 0.10% 0.13% 0.13% NA
Tropical Japonica  504 95.40% 4.00% 0.20% 0.40% NA
Japonica Intermediate  241 97.90% 1.70% 0.41% 0.00% NA
VI/Aromatic  96 86.50% 10.40% 3.12% 0.00% NA
Intermediate  90 74.40% 16.70% 6.67% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222716080 T -> DEL N N silent_mutation Average:58.167; most accessible tissue: Zhenshan97 flag leaf, score: 79.006 N N N N
vg0222716080 T -> C LOC_Os02g37630.1 upstream_gene_variant ; 2845.0bp to feature; MODIFIER silent_mutation Average:58.167; most accessible tissue: Zhenshan97 flag leaf, score: 79.006 N N N N
vg0222716080 T -> C LOC_Os02g37630-LOC_Os02g37654 intergenic_region ; MODIFIER silent_mutation Average:58.167; most accessible tissue: Zhenshan97 flag leaf, score: 79.006 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222716080 NA 4.26E-30 mr1095 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 1.53E-33 mr1098 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 9.70E-33 mr1099 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 3.68E-33 mr1101 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 1.22E-21 mr1120 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 2.31E-23 mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 3.23E-07 8.28E-18 mr1180 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 1.37E-07 2.78E-17 mr1183 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 4.33E-16 mr1240 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 3.19E-23 mr1247 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 3.15E-06 NA mr1448 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 3.37E-06 1.62E-16 mr1503 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 3.27E-28 mr1589 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 6.17E-26 mr1858 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 5.64E-26 mr1859 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 2.51E-06 NA mr1861 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 1.85E-29 mr1868 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 2.35E-24 mr1911 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 1.95E-17 mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 1.05E-08 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 7.71E-20 mr1936 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 2.28E-19 mr1961 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 1.30E-28 mr1095_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 5.03E-38 mr1098_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 2.83E-30 mr1099_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 4.38E-17 mr1113_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 1.53E-19 mr1117_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 1.61E-17 mr1119_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 7.08E-26 mr1120_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 3.29E-23 mr1123_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 4.23E-19 mr1240_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 2.89E-26 mr1247_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 4.81E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 1.85E-20 mr1911_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 3.99E-16 mr1918_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 1.18E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 4.25E-17 mr1936_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716080 NA 2.21E-16 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251