RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0222716046:

Variant ID: vg0222716046 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22716046
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.04, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

CTTTGTAGAGTAAACTGGACCTAAATACAATTTAGTACTCCCTCCGTCTAGATTCATTAGCATCAATATGAATGTGGGAAATGCTAGAATGACTTACATT[A/G]
TGAAACGGAGGGAGTACCTATATTATATACATATTTTTTTTAAAAAAGAAAGCATAAGAAGTTTTTGAGAAAATTCTATCACAAACCCATAATCTGAATT

Reverse complement sequence

AATTCAGATTATGGGTTTGTGATAGAATTTTCTCAAAAACTTCTTATGCTTTCTTTTTTAAAAAAAATATGTATATAATATAGGTACTCCCTCCGTTTCA[T/C]
AATGTAAGTCATTCTAGCATTTCCCACATTCATATTGATGCTAATGAATCTAGACGGAGGGAGTACTAAATTGTATTTAGGTCCAGTTTACTCTACAAAG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	53.40%	44.90%	1.69%	0.00%	NA
All Indica	2759	64.40%	34.50%	1.09%	0.00%	NA
All Japonica	1512	23.40%	73.50%	3.11%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	88.90%	8.10%	3.03%	0.00%	NA
Indica II	465	40.00%	59.10%	0.86%	0.00%	NA
Indica III	913	63.90%	35.90%	0.22%	0.00%	NA
Indica Intermediate	786	60.80%	38.40%	0.76%	0.00%	NA
Temperate Japonica	767	6.60%	89.20%	4.17%	0.00%	NA
Tropical Japonica	504	45.60%	52.40%	1.98%	0.00%	NA
Japonica Intermediate	241	30.30%	67.60%	2.07%	0.00%	NA
VI/Aromatic	96	91.70%	7.30%	1.04%	0.00%	NA
Intermediate	90	43.30%	54.40%	2.22%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222716046	A -> G	LOC_Os02g37630.1	upstream_gene_variant ; 2811.0bp to feature; MODIFIER	silent_mutation	Average:71.079; most accessible tissue: Callus, score: 91.289	N	N	N	N
vg0222716046	A -> G	LOC_Os02g37630-LOC_Os02g37654	intergenic_region ; MODIFIER	silent_mutation	Average:71.079; most accessible tissue: Callus, score: 91.289	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222716046	8.36E-06	NA	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0222716046	6.58E-09	7.29E-17	mr1067	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716046	2.60E-14	3.79E-38	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716046	8.70E-19	5.35E-33	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716046	2.05E-09	6.49E-33	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716046	1.76E-13	2.65E-27	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716046	6.86E-12	3.94E-32	mr1074	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716046	2.23E-17	1.56E-27	mr1074	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716046	1.23E-08	1.18E-30	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222716046	3.45E-13	1.39E-24	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 189 entries

Previous1 2 3 4 5…19Next

Search for Variation information by Variation ID:

Detailed information for vg0222716046:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact