| Variant ID: vg0222700046 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22700046 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.58, G: 0.42, others allele: 0.00, population size: 78. )
AGCAACATCACAAGTAGGGCTTTACGTGGGCTGACCCACTAACCCATTGTGGGTAACCTTTTGGTCAATCCACTTAATTAGCTTATAAGTAGATTTGTGG[A/G]
TTGATCCACTTAAACTGCTAATCACGAAACACGATTTTATTCCAAGCTAAAGAGATCATGTATTCATGTCAAGCCTGACTCGTTGTCGATTCGTTGATGT
ACATCAACGAATCGACAACGAGTCAGGCTTGACATGAATACATGATCTCTTTAGCTTGGAATAAAATCGTGTTTCGTGATTAGCAGTTTAAGTGGATCAA[T/C]
CCACAAATCTACTTATAAGCTAATTAAGTGGATTGACCAAAAGGTTACCCACAATGGGTTAGTGGGTCAGCCCACGTAAAGCCCTACTTGTGATGTTGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.00% | 43.40% | 0.30% | 1.25% | NA |
| All Indica | 2759 | 82.00% | 15.70% | 0.43% | 1.88% | NA |
| All Japonica | 1512 | 2.10% | 97.70% | 0.00% | 0.26% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 82.20% | 17.10% | 0.17% | 0.50% | NA |
| Indica II | 465 | 88.80% | 9.90% | 0.43% | 0.86% | NA |
| Indica III | 913 | 76.60% | 18.50% | 0.77% | 4.16% | NA |
| Indica Intermediate | 786 | 84.10% | 14.80% | 0.25% | 0.89% | NA |
| Temperate Japonica | 767 | 0.50% | 99.30% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 4.60% | 95.20% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 1.70% | 97.50% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 12.50% | 84.40% | 1.04% | 2.08% | NA |
| Intermediate | 90 | 35.60% | 62.20% | 1.11% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222700046 | A -> G | LOC_Os02g37610.1 | upstream_gene_variant ; 2252.0bp to feature; MODIFIER | silent_mutation | Average:74.292; most accessible tissue: Callus, score: 86.416 | N | N | N | N |
| vg0222700046 | A -> G | LOC_Os02g37620.1 | downstream_gene_variant ; 2310.0bp to feature; MODIFIER | silent_mutation | Average:74.292; most accessible tissue: Callus, score: 86.416 | N | N | N | N |
| vg0222700046 | A -> G | LOC_Os02g37610-LOC_Os02g37620 | intergenic_region ; MODIFIER | silent_mutation | Average:74.292; most accessible tissue: Callus, score: 86.416 | N | N | N | N |
| vg0222700046 | A -> DEL | N | N | silent_mutation | Average:74.292; most accessible tissue: Callus, score: 86.416 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222700046 | 1.76E-06 | NA | mr1067 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222700046 | 2.90E-06 | 4.46E-09 | mr1067 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222700046 | 3.17E-12 | 4.30E-21 | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222700046 | 1.58E-07 | 1.09E-08 | mr1069 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222700046 | 1.71E-09 | 3.35E-37 | mr1072 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222700046 | 8.40E-07 | 1.59E-08 | mr1072 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222700046 | NA | 8.58E-34 | mr1074 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222700046 | 9.08E-10 | 1.96E-40 | mr1075 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222700046 | 8.09E-06 | 2.02E-07 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222700046 | 9.89E-09 | 1.36E-24 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/