\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222665038:

Variant ID: vg0222665038 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22665038
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


CGAGAAGGCTAATCTCTGCAGGTGAATCGAAGAATACAAGCAAGAACAAGAAAAATAACAACCCAATTACAGATGAATGATTATTCAATAATTCGAAGTT[A/G]
GGGTTTCACAAACCAATGTAGTAGCGAAATTGCGATGGCAGAAGTAATCTAAGTAAAACCTAACCCTAACTCAATGACGACTACTAAATATATAGGTTCT

Reverse complement sequence

AGAACCTATATATTTAGTAGTCGTCATTGAGTTAGGGTTAGGTTTTACTTAGATTACTTCTGCCATCGCAATTTCGCTACTACATTGGTTTGTGAAACCC[T/C]
AACTTCGAATTATTGAATAATCATTCATCTGTAATTGGGTTGTTATTTTTCTTGTTCTTGCTTGTATTCTTCGATTCACCTGCAGAGATTAGCCTTCTCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.90% 23.00% 0.08% 0.00% NA
All Indica  2759 93.10% 6.80% 0.07% 0.00% NA
All Japonica  1512 45.40% 54.50% 0.07% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 83.40% 16.30% 0.34% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 97.50% 2.50% 0.00% 0.00% NA
Indica Intermediate  786 91.70% 8.30% 0.00% 0.00% NA
Temperate Japonica  767 20.30% 79.50% 0.13% 0.00% NA
Tropical Japonica  504 81.20% 18.80% 0.00% 0.00% NA
Japonica Intermediate  241 50.60% 49.40% 0.00% 0.00% NA
VI/Aromatic  96 54.20% 45.80% 0.00% 0.00% NA
Intermediate  90 68.90% 30.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222665038 A -> G LOC_Os02g37560.1 downstream_gene_variant ; 4983.0bp to feature; MODIFIER silent_mutation Average:42.146; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0222665038 A -> G LOC_Os02g37570.1 downstream_gene_variant ; 1643.0bp to feature; MODIFIER silent_mutation Average:42.146; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0222665038 A -> G LOC_Os02g37580.1 downstream_gene_variant ; 1417.0bp to feature; MODIFIER silent_mutation Average:42.146; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0222665038 A -> G LOC_Os02g37570-LOC_Os02g37580 intergenic_region ; MODIFIER silent_mutation Average:42.146; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222665038 4.51E-06 1.30E-06 mr1072 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038 9.02E-06 NA mr1098 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038 8.54E-06 NA mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038 2.95E-06 NA mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038 8.59E-06 NA mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038 6.05E-06 NA mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038 4.14E-06 NA mr1929 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038 5.48E-07 NA mr1067_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038 5.21E-09 NA mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038 2.82E-09 NA mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038 3.14E-07 NA mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038 1.31E-07 NA mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038 1.34E-07 NA mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038 9.92E-07 NA mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038 NA 2.17E-06 mr1782_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038 5.35E-06 NA mr1795_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038 4.42E-07 5.06E-06 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038 3.54E-06 NA mr1929_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038 3.02E-06 NA mr1962_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251