Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222665038:

Variant ID: vg0222665038 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22665038
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.05, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

CGAGAAGGCTAATCTCTGCAGGTGAATCGAAGAATACAAGCAAGAACAAGAAAAATAACAACCCAATTACAGATGAATGATTATTCAATAATTCGAAGTT[A/G]
GGGTTTCACAAACCAATGTAGTAGCGAAATTGCGATGGCAGAAGTAATCTAAGTAAAACCTAACCCTAACTCAATGACGACTACTAAATATATAGGTTCT

Reverse complement sequence

AGAACCTATATATTTAGTAGTCGTCATTGAGTTAGGGTTAGGTTTTACTTAGATTACTTCTGCCATCGCAATTTCGCTACTACATTGGTTTGTGAAACCC[T/C]
AACTTCGAATTATTGAATAATCATTCATCTGTAATTGGGTTGTTATTTTTCTTGTTCTTGCTTGTATTCTTCGATTCACCTGCAGAGATTAGCCTTCTCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.90%	23.00%	0.08%	0.00%	NA
All Indica	2759	93.10%	6.80%	0.07%	0.00%	NA
All Japonica	1512	45.40%	54.50%	0.07%	0.00%	NA
Aus	269	97.80%	2.20%	0.00%	0.00%	NA
Indica I	595	83.40%	16.30%	0.34%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	97.50%	2.50%	0.00%	0.00%	NA
Indica Intermediate	786	91.70%	8.30%	0.00%	0.00%	NA
Temperate Japonica	767	20.30%	79.50%	0.13%	0.00%	NA
Tropical Japonica	504	81.20%	18.80%	0.00%	0.00%	NA
Japonica Intermediate	241	50.60%	49.40%	0.00%	0.00%	NA
VI/Aromatic	96	54.20%	45.80%	0.00%	0.00%	NA
Intermediate	90	68.90%	30.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222665038	A -> G	LOC_Os02g37560.1	downstream_gene_variant ; 4983.0bp to feature; MODIFIER	silent_mutation	Average:42.146; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0222665038	A -> G	LOC_Os02g37570.1	downstream_gene_variant ; 1643.0bp to feature; MODIFIER	silent_mutation	Average:42.146; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0222665038	A -> G	LOC_Os02g37580.1	downstream_gene_variant ; 1417.0bp to feature; MODIFIER	silent_mutation	Average:42.146; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N
vg0222665038	A -> G	LOC_Os02g37570-LOC_Os02g37580	intergenic_region ; MODIFIER	silent_mutation	Average:42.146; most accessible tissue: Minghui63 panicle, score: 56.842	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222665038	4.51E-06	1.30E-06	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038	9.02E-06	NA	mr1098	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038	8.54E-06	NA	mr1098	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038	2.95E-06	NA	mr1148	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038	8.59E-06	NA	mr1868	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038	6.05E-06	NA	mr1918	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038	4.14E-06	NA	mr1929	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038	5.48E-07	NA	mr1067_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038	5.21E-09	NA	mr1072_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038	2.82E-09	NA	mr1075_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038	3.14E-07	NA	mr1077_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038	1.31E-07	NA	mr1124_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038	1.34E-07	NA	mr1149_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038	9.92E-07	NA	mr1441_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038	NA	2.17E-06	mr1782_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038	5.35E-06	NA	mr1795_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038	4.42E-07	5.06E-06	mr1918_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038	3.54E-06	NA	mr1929_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222665038	3.02E-06	NA	mr1962_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251