\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222664546:

Variant ID: vg0222664546 (JBrowse)Variation Type: INDEL
Chromosome: chr02Position: 22664546
Reference Allele: GTAlternative Allele: TT,G
Primary Allele: GTSecondary Allele: TT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGTGTTTTTCAAATGTGGCGTCTCTCTGAAATATTTTATAAATTTATTTGAAACATTTTTTATAAGCAATGAAACAATACTCGATTTTTTATGAATATT[GT/TT,G]
TTTATCAAAACATAATCATGTAAGATCTTATTGTAAAGATTTAATTATAATGAATTGAATGGTATAATCAGTTTATAGATTGAGAATACAATTTAAGAGA

Reverse complement sequence

TCTCTTAAATTGTATTCTCAATCTATAAACTGATTATACCATTCAATTCATTATAATTAAATCTTTACAATAAGATCTTACATGATTATGTTTTGATAAA[AC/AA,C]
AATATTCATAAAAAATCGAGTATTGTTTCATTGCTTATAAAAAATGTTTCAAATAAATTTATAAAATATTTCAGAGAGACGCCACATTTGAAAAACACCA

Allele Frequencies:

Populations Population SizeFrequency of GT(primary allele) Frequency of TT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.70% 4.50% 2.75% 0.00% G: 0.04%
All Indica  2759 88.10% 7.40% 4.46% 0.00% NA
All Japonica  1512 99.70% 0.10% 0.20% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 91.80% 0.00% 8.24% 0.00% NA
Indica II  465 72.70% 17.00% 10.32% 0.00% NA
Indica III  913 95.30% 4.50% 0.22% 0.00% NA
Indica Intermediate  786 86.10% 10.80% 3.05% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.13% 0.00% NA
Tropical Japonica  504 99.40% 0.20% 0.40% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 5.60% 3.33% 0.00% G: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222664546 GT -> G LOC_Os02g37560.1 downstream_gene_variant ; 4492.0bp to feature; MODIFIER silent_mutation Average:27.456; most accessible tissue: Callus, score: 66.193 N N N N
vg0222664546 GT -> G LOC_Os02g37570.1 downstream_gene_variant ; 1152.0bp to feature; MODIFIER silent_mutation Average:27.456; most accessible tissue: Callus, score: 66.193 N N N N
vg0222664546 GT -> G LOC_Os02g37580.1 downstream_gene_variant ; 1908.0bp to feature; MODIFIER silent_mutation Average:27.456; most accessible tissue: Callus, score: 66.193 N N N N
vg0222664546 GT -> G LOC_Os02g37570-LOC_Os02g37580 intergenic_region ; MODIFIER silent_mutation Average:27.456; most accessible tissue: Callus, score: 66.193 N N N N
vg0222664546 GT -> TT LOC_Os02g37560.1 downstream_gene_variant ; 4491.0bp to feature; MODIFIER silent_mutation Average:27.456; most accessible tissue: Callus, score: 66.193 N N N N
vg0222664546 GT -> TT LOC_Os02g37570.1 downstream_gene_variant ; 1151.0bp to feature; MODIFIER silent_mutation Average:27.456; most accessible tissue: Callus, score: 66.193 N N N N
vg0222664546 GT -> TT LOC_Os02g37580.1 downstream_gene_variant ; 1909.0bp to feature; MODIFIER silent_mutation Average:27.456; most accessible tissue: Callus, score: 66.193 N N N N
vg0222664546 GT -> TT LOC_Os02g37570-LOC_Os02g37580 intergenic_region ; MODIFIER silent_mutation Average:27.456; most accessible tissue: Callus, score: 66.193 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222664546 NA 1.40E-06 mr1069 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 NA 1.29E-08 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 NA 9.59E-06 mr1095 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 3.37E-06 2.00E-08 mr1098 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 4.07E-06 4.03E-07 mr1099 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 8.52E-06 6.62E-07 mr1101 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 NA 7.38E-08 mr1130 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 NA 4.34E-06 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 5.41E-07 NA mr1150 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 2.68E-07 1.88E-09 mr1150 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 NA 1.39E-06 mr1197 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 NA 5.18E-07 mr1224 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 NA 1.26E-06 mr1225 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 NA 3.23E-06 mr1254 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 4.52E-07 NA mr1589 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 3.49E-07 4.93E-09 mr1589 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 NA 3.30E-06 mr1833 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 2.42E-07 NA mr1868 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 3.40E-07 2.73E-07 mr1868 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 5.03E-06 NA mr1877 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 NA 3.53E-08 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 NA 6.93E-06 mr1911 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 2.19E-06 1.52E-13 mr1918 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 NA 1.53E-09 mr1918 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 1.39E-06 2.72E-12 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 NA 3.69E-07 mr1929 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 5.32E-06 NA mr1072_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 1.28E-06 6.08E-09 mr1072_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 NA 2.11E-08 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 1.38E-06 1.88E-10 mr1077_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 NA 3.58E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 NA 1.26E-07 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 NA 4.34E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 3.00E-06 NA mr1861_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 2.69E-07 1.14E-08 mr1861_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 NA 8.83E-06 mr1918_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222664546 NA 1.34E-06 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251