RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0222656032:

Variant ID: vg0222656032 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22656032
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.04, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:

GGCTACTCCTACGGATCAGTAGGACAGGACGGCAGCTACTCCTACTCGTATGGAGTACAGTACATCAATGGCGATCCTGCGGGTTGGTCTGGATGGAACA[A/G]
TGTGTGGTGGTTCGACCGCCGGTGCCCATCGGGCGCTTGTTGTGCCCGTGGGTTCAACGGCGATTGCTTCCGTTGCTGCCATCCGTGGCCGTAGTACATC

Reverse complement sequence

GATGTACTACGGCCACGGATGGCAGCAACGGAAGCAATCGCCGTTGAACCCACGGGCACAACAAGCGCCCGATGGGCACCGGCGGTCGAACCACCACACA[T/C]
TGTTCCATCCAGACCAACCCGCAGGATCGCCATTGATGTACTGTACTCCATACGAGTAGGAGTAGCTGCCGTCCTGTCCTACTGATCCGTAGGAGTAGCC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.40%	44.20%	0.34%	0.00%	NA
All Indica	2759	82.30%	17.30%	0.43%	0.00%	NA
All Japonica	1512	2.90%	97.00%	0.07%	0.00%	NA
Aus	269	97.80%	2.20%	0.00%	0.00%	NA
Indica I	595	81.00%	18.30%	0.67%	0.00%	NA
Indica II	465	88.60%	10.30%	1.08%	0.00%	NA
Indica III	913	78.90%	21.10%	0.00%	0.00%	NA
Indica Intermediate	786	83.60%	16.00%	0.38%	0.00%	NA
Temperate Japonica	767	0.70%	99.20%	0.13%	0.00%	NA
Tropical Japonica	504	6.50%	93.50%	0.00%	0.00%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	12.50%	87.50%	0.00%	0.00%	NA
Intermediate	90	33.30%	63.30%	3.33%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222656032	A -> G	LOC_Os02g37550.1	missense_variant ; p.Asn105Ser; MODERATE	nonsynonymous_codon	Average:69.495; most accessible tissue: Zhenshan97 young leaf, score: 83.199	unknown	unknown	TOLERATED	0.75

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222656032	2.35E-06	NA	mr1067	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222656032	1.23E-06	NA	mr1067	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222656032	2.90E-13	1.22E-21	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222656032	7.27E-10	2.66E-10	mr1069	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222656032	2.65E-10	3.28E-38	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222656032	1.08E-07	7.22E-09	mr1072	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222656032	NA	7.73E-34	mr1074	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222656032	1.76E-11	9.94E-43	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222656032	2.52E-08	1.41E-09	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222656032	1.95E-09	9.74E-26	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 123 entries

Previous1 2 3 4 5…13Next

Search for Variation information by Variation ID:

Detailed information for vg0222656032:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact