Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0222652351:

Variant ID: vg0222652351 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22652351
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GAACTAAAAAAACCGACTCAAATACGGATAACGTACCAAAATACCGGCAAAAACATCTTCAATTTTTATAATAGTAGAGAAGAGATACGGCCCTTTTAGG[C/T]
TGTATTCTTCCCCCATCTTTCCCAACTCACCACTCTCTTTTTCGTAGGCACGCTTTTCAAACTGCTAAACGGTGTGTTTTATAAAAAAAAATCTATACAA

Reverse complement sequence

TTGTATAGATTTTTTTTTATAAAACACACCGTTTAGCAGTTTGAAAAGCGTGCCTACGAAAAAGAGAGTGGTGAGTTGGGAAAGATGGGGGAAGAATACA[G/A]
CCTAAAAGGGCCGTATCTCTTCTCTACTATTATAAAAATTGAAGATGTTTTTGCCGGTATTTTGGTACGTTATCCGTATTTGAGTCGGTTTTTTTAGTTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.40%	18.30%	0.28%	0.02%	NA
All Indica	2759	92.50%	7.30%	0.22%	0.00%	NA
All Japonica	1512	57.50%	42.10%	0.33%	0.07%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	98.80%	1.00%	0.17%	0.00%	NA
Indica II	465	90.80%	8.60%	0.65%	0.00%	NA
Indica III	913	87.60%	12.20%	0.22%	0.00%	NA
Indica Intermediate	786	94.40%	5.60%	0.00%	0.00%	NA
Temperate Japonica	767	79.30%	20.50%	0.13%	0.13%	NA
Tropical Japonica	504	25.20%	74.20%	0.60%	0.00%	NA
Japonica Intermediate	241	55.60%	44.00%	0.41%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	71.10%	26.70%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222652351	C -> T	LOC_Os02g37530.1	upstream_gene_variant ; 2543.0bp to feature; MODIFIER	silent_mutation	Average:25.15; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0222652351	C -> T	LOC_Os02g37550.1	upstream_gene_variant ; 3159.0bp to feature; MODIFIER	silent_mutation	Average:25.15; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0222652351	C -> T	LOC_Os02g37540.1	downstream_gene_variant ; 419.0bp to feature; MODIFIER	silent_mutation	Average:25.15; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0222652351	C -> T	LOC_Os02g37540-LOC_Os02g37550	intergenic_region ; MODIFIER	silent_mutation	Average:25.15; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0222652351	C -> DEL	N	N	silent_mutation	Average:25.15; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222652351	NA	1.15E-06	mr1090_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222652351	NA	7.44E-08	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222652351	NA	3.49E-06	mr1096_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222652351	4.48E-06	2.96E-06	mr1099_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222652351	9.51E-06	3.42E-06	mr1150_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222652351	NA	1.73E-09	mr1222_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222652351	NA	2.49E-06	mr1222_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222652351	NA	9.57E-08	mr1863_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251