\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222652351:

Variant ID: vg0222652351 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22652351
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAACTAAAAAAACCGACTCAAATACGGATAACGTACCAAAATACCGGCAAAAACATCTTCAATTTTTATAATAGTAGAGAAGAGATACGGCCCTTTTAGG[C/T]
TGTATTCTTCCCCCATCTTTCCCAACTCACCACTCTCTTTTTCGTAGGCACGCTTTTCAAACTGCTAAACGGTGTGTTTTATAAAAAAAAATCTATACAA

Reverse complement sequence

TTGTATAGATTTTTTTTTATAAAACACACCGTTTAGCAGTTTGAAAAGCGTGCCTACGAAAAAGAGAGTGGTGAGTTGGGAAAGATGGGGGAAGAATACA[G/A]
CCTAAAAGGGCCGTATCTCTTCTCTACTATTATAAAAATTGAAGATGTTTTTGCCGGTATTTTGGTACGTTATCCGTATTTGAGTCGGTTTTTTTAGTTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.40% 18.30% 0.28% 0.02% NA
All Indica  2759 92.50% 7.30% 0.22% 0.00% NA
All Japonica  1512 57.50% 42.10% 0.33% 0.07% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 98.80% 1.00% 0.17% 0.00% NA
Indica II  465 90.80% 8.60% 0.65% 0.00% NA
Indica III  913 87.60% 12.20% 0.22% 0.00% NA
Indica Intermediate  786 94.40% 5.60% 0.00% 0.00% NA
Temperate Japonica  767 79.30% 20.50% 0.13% 0.13% NA
Tropical Japonica  504 25.20% 74.20% 0.60% 0.00% NA
Japonica Intermediate  241 55.60% 44.00% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 71.10% 26.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222652351 C -> T LOC_Os02g37530.1 upstream_gene_variant ; 2543.0bp to feature; MODIFIER silent_mutation Average:25.15; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0222652351 C -> T LOC_Os02g37550.1 upstream_gene_variant ; 3159.0bp to feature; MODIFIER silent_mutation Average:25.15; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0222652351 C -> T LOC_Os02g37540.1 downstream_gene_variant ; 419.0bp to feature; MODIFIER silent_mutation Average:25.15; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0222652351 C -> T LOC_Os02g37540-LOC_Os02g37550 intergenic_region ; MODIFIER silent_mutation Average:25.15; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0222652351 C -> DEL N N silent_mutation Average:25.15; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222652351 NA 1.15E-06 mr1090_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222652351 NA 7.44E-08 mr1094_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222652351 NA 3.49E-06 mr1096_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222652351 4.48E-06 2.96E-06 mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222652351 9.51E-06 3.42E-06 mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222652351 NA 1.73E-09 mr1222_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222652351 NA 2.49E-06 mr1222_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222652351 NA 9.57E-08 mr1863_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251