\
| Variant ID: vg0222652351 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22652351 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAACTAAAAAAACCGACTCAAATACGGATAACGTACCAAAATACCGGCAAAAACATCTTCAATTTTTATAATAGTAGAGAAGAGATACGGCCCTTTTAGG[C/T]
TGTATTCTTCCCCCATCTTTCCCAACTCACCACTCTCTTTTTCGTAGGCACGCTTTTCAAACTGCTAAACGGTGTGTTTTATAAAAAAAAATCTATACAA
TTGTATAGATTTTTTTTTATAAAACACACCGTTTAGCAGTTTGAAAAGCGTGCCTACGAAAAAGAGAGTGGTGAGTTGGGAAAGATGGGGGAAGAATACA[G/A]
CCTAAAAGGGCCGTATCTCTTCTCTACTATTATAAAAATTGAAGATGTTTTTGCCGGTATTTTGGTACGTTATCCGTATTTGAGTCGGTTTTTTTAGTTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.40% | 18.30% | 0.28% | 0.02% | NA |
| All Indica | 2759 | 92.50% | 7.30% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 57.50% | 42.10% | 0.33% | 0.07% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 90.80% | 8.60% | 0.65% | 0.00% | NA |
| Indica III | 913 | 87.60% | 12.20% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 79.30% | 20.50% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 25.20% | 74.20% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 55.60% | 44.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 26.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222652351 | C -> T | LOC_Os02g37530.1 | upstream_gene_variant ; 2543.0bp to feature; MODIFIER | silent_mutation | Average:25.15; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0222652351 | C -> T | LOC_Os02g37550.1 | upstream_gene_variant ; 3159.0bp to feature; MODIFIER | silent_mutation | Average:25.15; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0222652351 | C -> T | LOC_Os02g37540.1 | downstream_gene_variant ; 419.0bp to feature; MODIFIER | silent_mutation | Average:25.15; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0222652351 | C -> T | LOC_Os02g37540-LOC_Os02g37550 | intergenic_region ; MODIFIER | silent_mutation | Average:25.15; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0222652351 | C -> DEL | N | N | silent_mutation | Average:25.15; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222652351 | NA | 1.15E-06 | mr1090_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222652351 | NA | 7.44E-08 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222652351 | NA | 3.49E-06 | mr1096_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222652351 | 4.48E-06 | 2.96E-06 | mr1099_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222652351 | 9.51E-06 | 3.42E-06 | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222652351 | NA | 1.73E-09 | mr1222_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222652351 | NA | 2.49E-06 | mr1222_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222652351 | NA | 9.57E-08 | mr1863_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |