\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222647952:

Variant ID: vg0222647952 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22647952
Reference Allele: CAlternative Allele: A
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.04, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:


TGTCGCTGTACATTCTGGAAGTAATATCAAATTTGCGAATATATTCTAGTACTCCCCTCTAGTAAAAAAAAAACGTTTTGACTTTGAAACCACCAGTAAT[C/A]
TAGTACTCCTAATGTCAAATATTATTGGCAGGGGGGAGTAGAAGCTAGTTAAGTTATATTTTGGAAATAGACAGCTGTGTTTGATAGGAAAGGTTTACCT

Reverse complement sequence

AGGTAAACCTTTCCTATCAAACACAGCTGTCTATTTCCAAAATATAACTTAACTAGCTTCTACTCCCCCCTGCCAATAATATTTGACATTAGGAGTACTA[G/T]
ATTACTGGTGGTTTCAAAGTCAAAACGTTTTTTTTTTACTAGAGGGGAGTACTAGAATATATTCGCAAATTTGATATTACTTCCAGAATGTACAGCGACA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.20% 45.70% 0.13% 0.00% NA
All Indica  2759 86.10% 13.70% 0.14% 0.00% NA
All Japonica  1512 3.60% 96.30% 0.13% 0.00% NA
Aus  269 32.70% 67.30% 0.00% 0.00% NA
Indica I  595 81.80% 18.00% 0.17% 0.00% NA
Indica II  465 92.00% 7.70% 0.22% 0.00% NA
Indica III  913 88.00% 12.00% 0.00% 0.00% NA
Indica Intermediate  786 83.70% 16.00% 0.25% 0.00% NA
Temperate Japonica  767 0.80% 99.00% 0.26% 0.00% NA
Tropical Japonica  504 8.70% 91.30% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 9.40% 90.60% 0.00% 0.00% NA
Intermediate  90 36.70% 63.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222647952 C -> A LOC_Os02g37540.1 upstream_gene_variant ; 3007.0bp to feature; MODIFIER silent_mutation Average:40.266; most accessible tissue: Callus, score: 82.837 N N N N
vg0222647952 C -> A LOC_Os02g37520.1 downstream_gene_variant ; 2359.0bp to feature; MODIFIER silent_mutation Average:40.266; most accessible tissue: Callus, score: 82.837 N N N N
vg0222647952 C -> A LOC_Os02g37530.1 downstream_gene_variant ; 1617.0bp to feature; MODIFIER silent_mutation Average:40.266; most accessible tissue: Callus, score: 82.837 N N N N
vg0222647952 C -> A LOC_Os02g37520-LOC_Os02g37530 intergenic_region ; MODIFIER silent_mutation Average:40.266; most accessible tissue: Callus, score: 82.837 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222647952 NA 5.93E-11 mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222647952 6.12E-06 NA mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222647952 NA 2.08E-14 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222647952 7.46E-06 NA mr1108_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222647952 5.98E-08 2.08E-41 mr1110_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222647952 3.24E-06 NA mr1112_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222647952 3.60E-06 NA mr1114_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222647952 2.49E-07 NA mr1118_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222647952 NA 4.63E-12 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222647952 1.83E-07 NA mr1242_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222647952 4.55E-08 NA mr1496_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251