Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222647952:

Variant ID: vg0222647952 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22647952
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.04, others allele: 0.00, population size: 115. )

Flanking Sequence (100 bp) in Reference Genome:

TGTCGCTGTACATTCTGGAAGTAATATCAAATTTGCGAATATATTCTAGTACTCCCCTCTAGTAAAAAAAAAACGTTTTGACTTTGAAACCACCAGTAAT[C/A]
TAGTACTCCTAATGTCAAATATTATTGGCAGGGGGGAGTAGAAGCTAGTTAAGTTATATTTTGGAAATAGACAGCTGTGTTTGATAGGAAAGGTTTACCT

Reverse complement sequence

AGGTAAACCTTTCCTATCAAACACAGCTGTCTATTTCCAAAATATAACTTAACTAGCTTCTACTCCCCCCTGCCAATAATATTTGACATTAGGAGTACTA[G/T]
ATTACTGGTGGTTTCAAAGTCAAAACGTTTTTTTTTTACTAGAGGGGAGTACTAGAATATATTCGCAAATTTGATATTACTTCCAGAATGTACAGCGACA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.20%	45.70%	0.13%	0.00%	NA
All Indica	2759	86.10%	13.70%	0.14%	0.00%	NA
All Japonica	1512	3.60%	96.30%	0.13%	0.00%	NA
Aus	269	32.70%	67.30%	0.00%	0.00%	NA
Indica I	595	81.80%	18.00%	0.17%	0.00%	NA
Indica II	465	92.00%	7.70%	0.22%	0.00%	NA
Indica III	913	88.00%	12.00%	0.00%	0.00%	NA
Indica Intermediate	786	83.70%	16.00%	0.25%	0.00%	NA
Temperate Japonica	767	0.80%	99.00%	0.26%	0.00%	NA
Tropical Japonica	504	8.70%	91.30%	0.00%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	9.40%	90.60%	0.00%	0.00%	NA
Intermediate	90	36.70%	63.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222647952	C -> A	LOC_Os02g37540.1	upstream_gene_variant ; 3007.0bp to feature; MODIFIER	silent_mutation	Average:40.266; most accessible tissue: Callus, score: 82.837	N	N	N	N
vg0222647952	C -> A	LOC_Os02g37520.1	downstream_gene_variant ; 2359.0bp to feature; MODIFIER	silent_mutation	Average:40.266; most accessible tissue: Callus, score: 82.837	N	N	N	N
vg0222647952	C -> A	LOC_Os02g37530.1	downstream_gene_variant ; 1617.0bp to feature; MODIFIER	silent_mutation	Average:40.266; most accessible tissue: Callus, score: 82.837	N	N	N	N
vg0222647952	C -> A	LOC_Os02g37520-LOC_Os02g37530	intergenic_region ; MODIFIER	silent_mutation	Average:40.266; most accessible tissue: Callus, score: 82.837	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222647952	NA	5.93E-11	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222647952	6.12E-06	NA	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222647952	NA	2.08E-14	mr1592	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222647952	7.46E-06	NA	mr1108_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222647952	5.98E-08	2.08E-41	mr1110_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222647952	3.24E-06	NA	mr1112_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222647952	3.60E-06	NA	mr1114_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222647952	2.49E-07	NA	mr1118_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222647952	NA	4.63E-12	mr1188_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222647952	1.83E-07	NA	mr1242_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222647952	4.55E-08	NA	mr1496_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251