\
| Variant ID: vg0222647952 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22647952 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, A: 0.04, others allele: 0.00, population size: 115. )
TGTCGCTGTACATTCTGGAAGTAATATCAAATTTGCGAATATATTCTAGTACTCCCCTCTAGTAAAAAAAAAACGTTTTGACTTTGAAACCACCAGTAAT[C/A]
TAGTACTCCTAATGTCAAATATTATTGGCAGGGGGGAGTAGAAGCTAGTTAAGTTATATTTTGGAAATAGACAGCTGTGTTTGATAGGAAAGGTTTACCT
AGGTAAACCTTTCCTATCAAACACAGCTGTCTATTTCCAAAATATAACTTAACTAGCTTCTACTCCCCCCTGCCAATAATATTTGACATTAGGAGTACTA[G/T]
ATTACTGGTGGTTTCAAAGTCAAAACGTTTTTTTTTTACTAGAGGGGAGTACTAGAATATATTCGCAAATTTGATATTACTTCCAGAATGTACAGCGACA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.20% | 45.70% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 86.10% | 13.70% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 3.60% | 96.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 32.70% | 67.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 81.80% | 18.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 92.00% | 7.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 88.00% | 12.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 83.70% | 16.00% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 0.80% | 99.00% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 8.70% | 91.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 9.40% | 90.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 36.70% | 63.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222647952 | C -> A | LOC_Os02g37540.1 | upstream_gene_variant ; 3007.0bp to feature; MODIFIER | silent_mutation | Average:40.266; most accessible tissue: Callus, score: 82.837 | N | N | N | N |
| vg0222647952 | C -> A | LOC_Os02g37520.1 | downstream_gene_variant ; 2359.0bp to feature; MODIFIER | silent_mutation | Average:40.266; most accessible tissue: Callus, score: 82.837 | N | N | N | N |
| vg0222647952 | C -> A | LOC_Os02g37530.1 | downstream_gene_variant ; 1617.0bp to feature; MODIFIER | silent_mutation | Average:40.266; most accessible tissue: Callus, score: 82.837 | N | N | N | N |
| vg0222647952 | C -> A | LOC_Os02g37520-LOC_Os02g37530 | intergenic_region ; MODIFIER | silent_mutation | Average:40.266; most accessible tissue: Callus, score: 82.837 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222647952 | NA | 5.93E-11 | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222647952 | 6.12E-06 | NA | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222647952 | NA | 2.08E-14 | mr1592 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222647952 | 7.46E-06 | NA | mr1108_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222647952 | 5.98E-08 | 2.08E-41 | mr1110_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222647952 | 3.24E-06 | NA | mr1112_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222647952 | 3.60E-06 | NA | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222647952 | 2.49E-07 | NA | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222647952 | NA | 4.63E-12 | mr1188_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222647952 | 1.83E-07 | NA | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222647952 | 4.55E-08 | NA | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |