\
| Variant ID: vg0222628695 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr02 | Position: 22628695 |
| Reference Allele: CA | Alternative Allele: TA,C |
| Primary Allele: CA | Secondary Allele: TA |
Inferred Ancestral Allele: Not determined.
AATTAAATATGTTTTTATAATAAATTTATCTTATGTCAAAAATATTATTATTTTTTTATAAACTTAATTAAACTTTAAGCAGTTTGGCTTTGACCAAATT[CA/TA,C]
AAACATCTTATAACGTAAAACGGAGGGAGTACTTCGCATGCTTACCTTCTCATCACACAGCAGATCATATACACCGATCAATCGATCAGTGCCTAGCTAG
CTAGCTAGGCACTGATCGATTGATCGGTGTATATGATCTGCTGTGTGATGAGAAGGTAAGCATGCGAAGTACTCCCTCCGTTTTACGTTATAAGATGTTT[TG/TA,G]
AATTTGGTCAAAGCCAAACTGCTTAAAGTTTAATTAAGTTTATAAAAAAATAATAATATTTTTGACATAAGATAAATTTATTATAAAAACATATTTAATT
| Populations | Population Size | Frequency of CA(primary allele) | Frequency of TA(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.20% | 6.70% | 0.00% | 0.00% | C: 0.06% |
| All Indica | 2759 | 95.60% | 4.30% | 0.00% | 0.00% | C: 0.07% |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 33.10% | 66.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.50% | 7.30% | 0.00% | 0.00% | C: 0.22% |
| Indica III | 913 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.90% | 8.00% | 0.00% | 0.00% | C: 0.13% |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 9.40% | 0.00% | 0.00% | C: 1.04% |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222628695 | CA -> TA | LOC_Os02g37490.1 | downstream_gene_variant ; 1504.0bp to feature; MODIFIER | silent_mutation | Average:78.744; most accessible tissue: Callus, score: 99.185 | N | N | N | N |
| vg0222628695 | CA -> TA | LOC_Os02g37490-LOC_Os02g37500 | intergenic_region ; MODIFIER | silent_mutation | Average:78.744; most accessible tissue: Callus, score: 99.185 | N | N | N | N |
| vg0222628695 | CA -> C | LOC_Os02g37490.1 | downstream_gene_variant ; 1505.0bp to feature; MODIFIER | silent_mutation | Average:78.744; most accessible tissue: Callus, score: 99.185 | N | N | N | N |
| vg0222628695 | CA -> C | LOC_Os02g37490-LOC_Os02g37500 | intergenic_region ; MODIFIER | silent_mutation | Average:78.744; most accessible tissue: Callus, score: 99.185 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222628695 | 5.34E-06 | NA | mr1069 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 1.10E-06 | NA | mr1098 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 3.82E-07 | NA | mr1099 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 7.42E-08 | 7.97E-26 | mr1101 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | NA | 2.47E-17 | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 7.76E-06 | 9.38E-22 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 7.07E-06 | 1.93E-18 | mr1116 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 2.28E-07 | 4.08E-23 | mr1117 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 2.02E-07 | 6.09E-16 | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 3.73E-06 | 5.19E-19 | mr1119 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 1.89E-06 | 3.08E-21 | mr1120 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 8.71E-08 | 2.45E-27 | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 2.16E-06 | NA | mr1150 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 1.34E-07 | NA | mr1180 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 1.40E-06 | NA | mr1183 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | NA | 3.92E-17 | mr1240 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 1.13E-08 | 3.94E-24 | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 2.37E-07 | 1.08E-23 | mr1247 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 1.88E-08 | NA | mr1495 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 9.55E-09 | 2.58E-22 | mr1496 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 7.69E-06 | NA | mr1503 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 1.49E-06 | NA | mr1917 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 4.76E-07 | 1.36E-19 | mr1936 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 5.11E-06 | NA | mr1962 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 3.47E-06 | NA | mr1095_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 6.52E-10 | NA | mr1098_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 1.33E-07 | NA | mr1098_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 3.82E-09 | 2.32E-23 | mr1099_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 1.43E-06 | NA | mr1099_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 9.55E-10 | 1.48E-24 | mr1113_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 3.44E-09 | 7.13E-25 | mr1114_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 5.25E-11 | 1.99E-27 | mr1117_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 5.71E-10 | 5.17E-16 | mr1118_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 1.21E-09 | 8.64E-25 | mr1119_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 9.17E-10 | 5.42E-26 | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 1.24E-13 | 3.99E-32 | mr1123_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 1.18E-10 | NA | mr1150_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 6.25E-08 | NA | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 1.95E-10 | 8.14E-25 | mr1240_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 6.57E-12 | 3.63E-28 | mr1242_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 5.18E-11 | 1.03E-29 | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 7.79E-10 | NA | mr1495_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 2.84E-13 | 1.25E-24 | mr1496_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 1.49E-09 | 6.28E-21 | mr1936_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | 2.54E-06 | 8.49E-17 | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222628695 | NA | 1.57E-06 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |