\
| Variant ID: vg0222625642 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22625642 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 119. )
TTATTTATTCTTTTCATATCATTTGATTCATTGTTAAATATACTTTCATGTACGCATATAGTTTTACATATTTCATAAAAAAATTTTTAATAAGACGAGC[G/A]
GTCAAACATGTGCTAAAAAGTCAACGGTGTCAACCATTTTGAAATGGAGTAATAGTTTGGTGTAAAACTTTTTGAGTTCCGGATTCACGTTGTCTAAAGA
TCTTTAGACAACGTGAATCCGGAACTCAAAAAGTTTTACACCAAACTATTACTCCATTTCAAAATGGTTGACACCGTTGACTTTTTAGCACATGTTTGAC[C/T]
GCTCGTCTTATTAAAAATTTTTTTATGAAATATGTAAAACTATATGCGTACATGAAAGTATATTTAACAATGAATCAAATGATATGAAAAGAATAAATAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 52.50% | 47.20% | 0.06% | 0.25% | NA |
| All Indica | 2759 | 83.40% | 16.30% | 0.11% | 0.22% | NA |
| All Japonica | 1512 | 3.40% | 96.30% | 0.00% | 0.26% | NA |
| Aus | 269 | 36.10% | 63.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 81.20% | 18.50% | 0.34% | 0.00% | NA |
| Indica II | 465 | 92.00% | 7.30% | 0.22% | 0.43% | NA |
| Indica III | 913 | 83.20% | 16.60% | 0.00% | 0.11% | NA |
| Indica Intermediate | 786 | 80.00% | 19.60% | 0.00% | 0.38% | NA |
| Temperate Japonica | 767 | 0.70% | 99.10% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 8.50% | 91.10% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 32.20% | 65.60% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222625642 | G -> A | LOC_Os02g37490.1 | upstream_gene_variant ; 630.0bp to feature; MODIFIER | silent_mutation | Average:36.231; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0222625642 | G -> A | LOC_Os02g37480.1 | downstream_gene_variant ; 2454.0bp to feature; MODIFIER | silent_mutation | Average:36.231; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0222625642 | G -> A | LOC_Os02g37480-LOC_Os02g37490 | intergenic_region ; MODIFIER | silent_mutation | Average:36.231; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg0222625642 | G -> DEL | N | N | silent_mutation | Average:36.231; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222625642 | 2.54E-06 | 3.67E-15 | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222625642 | NA | 7.57E-07 | mr1188 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222625642 | NA | 1.13E-06 | mr1045_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222625642 | 5.91E-06 | 7.96E-16 | mr1188_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222625642 | NA | 2.95E-06 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222625642 | NA | 1.26E-07 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |