Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222625642:

Variant ID: vg0222625642 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22625642
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

TTATTTATTCTTTTCATATCATTTGATTCATTGTTAAATATACTTTCATGTACGCATATAGTTTTACATATTTCATAAAAAAATTTTTAATAAGACGAGC[G/A]
GTCAAACATGTGCTAAAAAGTCAACGGTGTCAACCATTTTGAAATGGAGTAATAGTTTGGTGTAAAACTTTTTGAGTTCCGGATTCACGTTGTCTAAAGA

Reverse complement sequence

TCTTTAGACAACGTGAATCCGGAACTCAAAAAGTTTTACACCAAACTATTACTCCATTTCAAAATGGTTGACACCGTTGACTTTTTAGCACATGTTTGAC[C/T]
GCTCGTCTTATTAAAAATTTTTTTATGAAATATGTAAAACTATATGCGTACATGAAAGTATATTTAACAATGAATCAAATGATATGAAAAGAATAAATAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.50%	47.20%	0.06%	0.25%	NA
All Indica	2759	83.40%	16.30%	0.11%	0.22%	NA
All Japonica	1512	3.40%	96.30%	0.00%	0.26%	NA
Aus	269	36.10%	63.90%	0.00%	0.00%	NA
Indica I	595	81.20%	18.50%	0.34%	0.00%	NA
Indica II	465	92.00%	7.30%	0.22%	0.43%	NA
Indica III	913	83.20%	16.60%	0.00%	0.11%	NA
Indica Intermediate	786	80.00%	19.60%	0.00%	0.38%	NA
Temperate Japonica	767	0.70%	99.10%	0.00%	0.26%	NA
Tropical Japonica	504	8.50%	91.10%	0.00%	0.40%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	32.20%	65.60%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222625642	G -> A	LOC_Os02g37490.1	upstream_gene_variant ; 630.0bp to feature; MODIFIER	silent_mutation	Average:36.231; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0222625642	G -> A	LOC_Os02g37480.1	downstream_gene_variant ; 2454.0bp to feature; MODIFIER	silent_mutation	Average:36.231; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0222625642	G -> A	LOC_Os02g37480-LOC_Os02g37490	intergenic_region ; MODIFIER	silent_mutation	Average:36.231; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg0222625642	G -> DEL	N	N	silent_mutation	Average:36.231; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222625642	2.54E-06	3.67E-15	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222625642	NA	7.57E-07	mr1188	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222625642	NA	1.13E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222625642	5.91E-06	7.96E-16	mr1188_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222625642	NA	2.95E-06	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222625642	NA	1.26E-07	mr1968_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251