RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0222624829:

Variant ID: vg0222624829 (JBrowse)	Variation Type: SNP
Chromosome: chr02	Position: 22624829
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

ACAGTAGTCACAGGTCATCAAAATTAGGTATAACAAGGTGTGAACACCCAACATATTGAGGTAGTTATGGAAATGTTATGTTCGATTGCTCTTATTGAGT[G/A]
AACATCTCCGTTCTCCGCCCATCTATATTTTAAAGTTGCGTCCGCCACTACTCCCAAGTATATCAAATGGGCTAGGTTTTTTCACACAAATGTGAACGAC

Reverse complement sequence

GTCGTTCACATTTGTGTGAAAAAACCTAGCCCATTTGATATACTTGGGAGTAGTGGCGGACGCAACTTTAAAATATAGATGGGCGGAGAACGGAGATGTT[C/T]
ACTCAATAAGAGCAATCGAACATAACATTTCCATAACTACCTCAATATGTTGGGTGTTCACACCTTGTTATACCTAATTTTGATGACCTGTGACTACTGT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.60%	2.90%	0.53%	0.00%	NA
All Indica	2759	94.30%	4.80%	0.87%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.70%	0.00%	0.34%	0.00%	NA
Indica II	465	77.60%	18.90%	3.44%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	93.50%	5.70%	0.76%	0.00%	NA
Temperate Japonica	767	99.70%	0.30%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	2.20%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0222624829	G -> A	LOC_Os02g37490.1	upstream_gene_variant ; 1443.0bp to feature; MODIFIER	silent_mutation	Average:57.763; most accessible tissue: Zhenshan97 young leaf, score: 83.831	N	N	N	N
vg0222624829	G -> A	LOC_Os02g37470.1	downstream_gene_variant ; 4724.0bp to feature; MODIFIER	silent_mutation	Average:57.763; most accessible tissue: Zhenshan97 young leaf, score: 83.831	N	N	N	N
vg0222624829	G -> A	LOC_Os02g37480.1	downstream_gene_variant ; 1641.0bp to feature; MODIFIER	silent_mutation	Average:57.763; most accessible tissue: Zhenshan97 young leaf, score: 83.831	N	N	N	N
vg0222624829	G -> A	LOC_Os02g37480-LOC_Os02g37490	intergenic_region ; MODIFIER	silent_mutation	Average:57.763; most accessible tissue: Zhenshan97 young leaf, score: 83.831	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0222624829	1.72E-06	NA	mr1067	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624829	2.26E-07	NA	mr1069	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624829	2.05E-07	3.71E-11	mr1069	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624829	1.59E-07	NA	mr1072	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624829	5.32E-08	6.66E-11	mr1072	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624829	2.94E-06	NA	mr1074	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624829	1.31E-06	2.68E-07	mr1074	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624829	8.11E-07	NA	mr1075	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624829	8.27E-08	2.03E-09	mr1075	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222624829	1.17E-09	NA	mr1077	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 76 entries

Previous1 2 3 4 5…8Next

Search for Variation information by Variation ID:

Detailed information for vg0222624829:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact