Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222612950:

Variant ID: vg0222612950 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22612950
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAGTAGGCTTATGGCCTGTTTGTATTGTTTGCTTTGTATGTCGCTTAGATTCCGGCTCTCCCGATGTTCCGGTGTACTTTGAAATAGTCGTCGAGGTT[C/T]
CTCCAGGAGCATAGCAAGGCAAGTCATGCTTGTCACTTGAACATATTGATCCTATATTGCAAATGCTCTATCATTTTCCTTTAAGTACTGCATCATTTTA

Reverse complement sequence

TAAAATGATGCAGTACTTAAAGGAAAATGATAGAGCATTTGCAATATAGGATCAATATGTTCAAGTGACAAGCATGACTTGCCTTGCTATGCTCCTGGAG[G/A]
AACCTCGACGACTATTTCAAAGTACACCGGAACATCGGGAGAGCCGGAATCTAAGCGACATACAAAGCAAACAATACAAACAGGCCATAAGCCTACTGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.90% 47.90% 0.25% 0.00% NA
All Indica  2759 82.30% 17.40% 0.36% 0.00% NA
All Japonica  1512 3.50% 96.40% 0.13% 0.00% NA
Aus  269 36.40% 63.60% 0.00% 0.00% NA
Indica I  595 80.30% 19.00% 0.67% 0.00% NA
Indica II  465 92.30% 7.50% 0.22% 0.00% NA
Indica III  913 80.90% 18.90% 0.11% 0.00% NA
Indica Intermediate  786 79.40% 20.10% 0.51% 0.00% NA
Temperate Japonica  767 0.70% 99.10% 0.26% 0.00% NA
Tropical Japonica  504 8.50% 91.50% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 33.30% 66.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222612950 C -> T LOC_Os02g37450.1 upstream_gene_variant ; 867.0bp to feature; MODIFIER silent_mutation Average:39.19; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0222612950 C -> T LOC_Os02g37460.1 upstream_gene_variant ; 1341.0bp to feature; MODIFIER silent_mutation Average:39.19; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0222612950 C -> T LOC_Os02g37470.1 upstream_gene_variant ; 4553.0bp to feature; MODIFIER silent_mutation Average:39.19; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0222612950 C -> T LOC_Os02g37440.1 downstream_gene_variant ; 3742.0bp to feature; MODIFIER silent_mutation Average:39.19; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg0222612950 C -> T LOC_Os02g37450-LOC_Os02g37460 intergenic_region ; MODIFIER silent_mutation Average:39.19; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222612950 1.77E-06 2.20E-15 mr1188 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222612950 NA 4.59E-07 mr1188 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222612950 4.11E-06 1.65E-15 mr1188_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222612950 NA 3.30E-07 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251