Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0222594490:

Variant ID: vg0222594490 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22594490
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 124. )

Flanking Sequence (100 bp) in Reference Genome:


TGCCACCCGGATCCGCACGCTACGCGATCGGATCCGGTGTTTCCTCAGTGGAGATGATGGATGTAGGTGTGGTGGGGCTACGGACAACGGTGATGTAGCA[A/G]
TCTAGGCGTTGGCTCAGGGTGTGGACAATGAGGCAGAGTCAGGTTGCGGTTGATGTAACAAGCTTGCCGCATGTAGTGGTGAGGTCACCGGCGATGTTGA

Reverse complement sequence

TCAACATCGCCGGTGACCTCACCACTACATGCGGCAAGCTTGTTACATCAACCGCAACCTGACTCTGCCTCATTGTCCACACCCTGAGCCAACGCCTAGA[T/C]
TGCTACATCACCGTTGTCCGTAGCCCCACCACACCTACATCCATCATCTCCACTGAGGAAACACCGGATCCGATCGCGTAGCGTGCGGATCCGGGTGGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.00% 10.30% 1.67% 0.00% NA
All Indica  2759 97.90% 1.60% 0.47% 0.00% NA
All Japonica  1512 67.40% 28.50% 4.10% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 93.80% 4.50% 1.68% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 97.60% 2.00% 0.38% 0.00% NA
Temperate Japonica  767 41.90% 52.20% 6.00% 0.00% NA
Tropical Japonica  504 98.20% 0.60% 1.19% 0.00% NA
Japonica Intermediate  241 84.20% 11.60% 4.15% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 84.40% 12.20% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222594490 A -> G LOC_Os02g37400.1 upstream_gene_variant ; 4761.0bp to feature; MODIFIER silent_mutation Average:75.861; most accessible tissue: Zhenshan97 panicle, score: 89.389 N N N N
vg0222594490 A -> G LOC_Os02g37410.1 upstream_gene_variant ; 878.0bp to feature; MODIFIER silent_mutation Average:75.861; most accessible tissue: Zhenshan97 panicle, score: 89.389 N N N N
vg0222594490 A -> G LOC_Os02g37420.1 upstream_gene_variant ; 4897.0bp to feature; MODIFIER silent_mutation Average:75.861; most accessible tissue: Zhenshan97 panicle, score: 89.389 N N N N
vg0222594490 A -> G LOC_Os02g37400-LOC_Os02g37410 intergenic_region ; MODIFIER silent_mutation Average:75.861; most accessible tissue: Zhenshan97 panicle, score: 89.389 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0222594490 A G -0.03 0.01 0.0 -0.04 -0.09 -0.11

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222594490 NA 5.70E-07 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222594490 1.99E-06 NA mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222594490 3.48E-06 3.48E-06 mr1166 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222594490 4.28E-07 NA mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222594490 7.94E-06 NA mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222594490 2.92E-07 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222594490 3.91E-06 NA mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222594490 NA 5.07E-08 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222594490 6.01E-07 NA mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222594490 1.18E-06 NA mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222594490 6.82E-08 NA mr1586 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222594490 7.23E-06 NA mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222594490 NA 4.46E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222594490 8.98E-06 NA mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222594490 NA 3.13E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222594490 NA 6.63E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222594490 NA 2.55E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251