Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0222581124:

Variant ID: vg0222581124 (JBrowse)Variation Type: SNP
Chromosome: chr02Position: 22581124
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, A: 0.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:


CAAATGTCAAAAAGTCAAGATAAAAAAAAGGCCGAAATGTTGAGCTTTGCTGTAAATAATCCTCGACTCTAGACACACGATATCTTCTTTTGAGTAATGT[T/A]
ACTGATAGGGATGATTGACTTTTTGCTTCCAGCTACCCGATCGATTGTGATTTTGTTTTAGCTTTGTTGGTGTTTTCCGTTTGTTTTTATGGGGAATTTG

Reverse complement sequence

CAAATTCCCCATAAAAACAAACGGAAAACACCAACAAAGCTAAAACAAAATCACAATCGATCGGGTAGCTGGAAGCAAAAAGTCAATCATCCCTATCAGT[A/T]
ACATTACTCAAAAGAAGATATCGTGTGTCTAGAGTCGAGGATTATTTACAGCAAAGCTCAACATTTCGGCCTTTTTTTTATCTTGACTTTTTGACATTTG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.40% 1.60% 0.02% 0.00% NA
All Indica  2759 98.20% 1.70% 0.04% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 90.00% 10.00% 0.00% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 99.50% 0.40% 0.11% 0.00% NA
Indica Intermediate  786 95.90% 4.10% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0222581124 T -> A LOC_Os02g37380.1 upstream_gene_variant ; 511.0bp to feature; MODIFIER silent_mutation Average:31.003; most accessible tissue: Callus, score: 58.848 N N N N
vg0222581124 T -> A LOC_Os02g37390.1 downstream_gene_variant ; 4903.0bp to feature; MODIFIER silent_mutation Average:31.003; most accessible tissue: Callus, score: 58.848 N N N N
vg0222581124 T -> A LOC_Os02g37380-LOC_Os02g37390 intergenic_region ; MODIFIER silent_mutation Average:31.003; most accessible tissue: Callus, score: 58.848 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0222581124 1.19E-06 NA mr1098_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222581124 2.38E-07 NA mr1099_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222581124 2.13E-06 NA mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222581124 6.96E-08 1.04E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222581124 9.78E-07 NA mr1150_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222581124 7.22E-06 1.22E-06 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222581124 6.53E-08 7.62E-06 mr1247_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222581124 NA 1.95E-06 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0222581124 NA 2.16E-06 mr1968_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251