Variant ID: vg0222581124 (JBrowse) | Variation Type: SNP |
Chromosome: chr02 | Position: 22581124 |
Reference Allele: T | Alternative Allele: A |
Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, A: 0.00, others allele: 0.00, population size: 272. )
CAAATGTCAAAAAGTCAAGATAAAAAAAAGGCCGAAATGTTGAGCTTTGCTGTAAATAATCCTCGACTCTAGACACACGATATCTTCTTTTGAGTAATGT[T/A]
ACTGATAGGGATGATTGACTTTTTGCTTCCAGCTACCCGATCGATTGTGATTTTGTTTTAGCTTTGTTGGTGTTTTCCGTTTGTTTTTATGGGGAATTTG
CAAATTCCCCATAAAAACAAACGGAAAACACCAACAAAGCTAAAACAAAATCACAATCGATCGGGTAGCTGGAAGCAAAAAGTCAATCATCCCTATCAGT[A/T]
ACATTACTCAAAAGAAGATATCGTGTGTCTAGAGTCGAGGATTATTTACAGCAAAGCTCAACATTTCGGCCTTTTTTTTATCTTGACTTTTTGACATTTG
Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 98.40% | 1.60% | 0.02% | 0.00% | NA |
All Indica | 2759 | 98.20% | 1.70% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Aus | 269 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.50% | 0.40% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0222581124 | T -> A | LOC_Os02g37380.1 | upstream_gene_variant ; 511.0bp to feature; MODIFIER | silent_mutation | Average:31.003; most accessible tissue: Callus, score: 58.848 | N | N | N | N |
vg0222581124 | T -> A | LOC_Os02g37390.1 | downstream_gene_variant ; 4903.0bp to feature; MODIFIER | silent_mutation | Average:31.003; most accessible tissue: Callus, score: 58.848 | N | N | N | N |
vg0222581124 | T -> A | LOC_Os02g37380-LOC_Os02g37390 | intergenic_region ; MODIFIER | silent_mutation | Average:31.003; most accessible tissue: Callus, score: 58.848 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0222581124 | 1.19E-06 | NA | mr1098_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222581124 | 2.38E-07 | NA | mr1099_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222581124 | 2.13E-06 | NA | mr1120_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222581124 | 6.96E-08 | 1.04E-06 | mr1123_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222581124 | 9.78E-07 | NA | mr1150_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222581124 | 7.22E-06 | 1.22E-06 | mr1242_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222581124 | 6.53E-08 | 7.62E-06 | mr1247_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222581124 | NA | 1.95E-06 | mr1378_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0222581124 | NA | 2.16E-06 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |