\
| Variant ID: vg0222574285 (JBrowse) | Variation Type: SNP |
| Chromosome: chr02 | Position: 22574285 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.03, others allele: 0.00, population size: 99. )
ACCTTAAGATACTTATTATTACCTCCGTTTTAGGTTATAAGAAGATTCATTAACATCTATATGAATGTGGGCAATGCTAGAAAGTCTTATAATATGAAAC[G/A]
GAGGAAGTAGTACATAGAGATACCAAATTTTACACTAAAAAATATGGTACCTCTAGATACCTTCTCAAGAATAGTAAAATTACCCTACTAACAATAGAGA
TCTCTATTGTTAGTAGGGTAATTTTACTATTCTTGAGAAGGTATCTAGAGGTACCATATTTTTTAGTGTAAAATTTGGTATCTCTATGTACTACTTCCTC[C/T]
GTTTCATATTATAAGACTTTCTAGCATTGCCCACATTCATATAGATGTTAATGAATCTTCTTATAACCTAAAACGGAGGTAATAATAAGTATCTTAAGGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.60% | 46.00% | 0.34% | 0.00% | NA |
| All Indica | 2759 | 84.90% | 14.50% | 0.54% | 0.00% | NA |
| All Japonica | 1512 | 4.00% | 96.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 37.20% | 62.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 78.80% | 19.70% | 1.51% | 0.00% | NA |
| Indica II | 465 | 93.30% | 6.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 84.90% | 14.90% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 84.60% | 15.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 9.90% | 90.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 32.20% | 66.70% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0222574285 | G -> A | LOC_Os02g37360.1 | upstream_gene_variant ; 944.0bp to feature; MODIFIER | silent_mutation | Average:37.843; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0222574285 | G -> A | LOC_Os02g37350.1 | downstream_gene_variant ; 2757.0bp to feature; MODIFIER | silent_mutation | Average:37.843; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0222574285 | G -> A | LOC_Os02g37380.1 | downstream_gene_variant ; 4875.0bp to feature; MODIFIER | silent_mutation | Average:37.843; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0222574285 | G -> A | LOC_Os02g37360-LOC_Os02g37380 | intergenic_region ; MODIFIER | silent_mutation | Average:37.843; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0222574285 | NA | 1.46E-39 | mr1124 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222574285 | 1.52E-06 | 1.27E-12 | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222574285 | NA | 3.05E-15 | mr1592 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222574285 | 1.37E-06 | NA | mr1067_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0222574285 | 1.47E-06 | 2.75E-13 | mr1188_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |